Incidental Mutation 'R7273:Prepl'
ID565426
Institutional Source Beutler Lab
Gene Symbol Prepl
Ensembl Gene ENSMUSG00000024127
Gene Nameprolyl endopeptidase-like
Synonyms2810457N15Rik, 9530014L06Rik, D030028O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location85063477-85090267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85081992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 128 (V128G)
Ref Sequence ENSEMBL: ENSMUSP00000130967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072406] [ENSMUST00000171795]
Predicted Effect probably benign
Transcript: ENSMUST00000072406
AA Change: V41G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072239
Gene: ENSMUSG00000024127
AA Change: V41G

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 15 339 7.4e-28 PFAM
Pfam:Peptidase_S9 399 623 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171795
AA Change: V128G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130967
Gene: ENSMUSG00000024127
AA Change: V128G

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 86 428 5.2e-30 PFAM
Pfam:Peptidase_S9 486 710 2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants encoding either the same or different isoforms have been described for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired growth and neonatal hypotonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Prepl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Prepl APN 17 85078507 missense probably damaging 1.00
IGL01375:Prepl APN 17 85071991 missense possibly damaging 0.92
IGL01618:Prepl APN 17 85066281 missense probably damaging 1.00
IGL01633:Prepl APN 17 85072016 missense probably benign 0.03
IGL01730:Prepl APN 17 85081175 missense possibly damaging 0.82
IGL02728:Prepl APN 17 85070582 missense probably damaging 1.00
R0126:Prepl UTSW 17 85083242 missense probably benign 0.19
R0243:Prepl UTSW 17 85065038 unclassified probably null
R1071:Prepl UTSW 17 85070512 missense probably damaging 1.00
R1437:Prepl UTSW 17 85088357 missense probably damaging 1.00
R1638:Prepl UTSW 17 85072081 missense probably benign 0.04
R1892:Prepl UTSW 17 85088450 missense possibly damaging 0.82
R1967:Prepl UTSW 17 85088551 start codon destroyed probably null 0.99
R4196:Prepl UTSW 17 85081154 missense probably benign
R4630:Prepl UTSW 17 85083231 missense probably benign 0.00
R4632:Prepl UTSW 17 85083231 missense probably benign 0.00
R4895:Prepl UTSW 17 85081066 missense probably damaging 1.00
R4932:Prepl UTSW 17 85078504 missense possibly damaging 0.66
R4969:Prepl UTSW 17 85088474 missense probably benign 0.00
R5954:Prepl UTSW 17 85064649 missense probably benign 0.04
R6259:Prepl UTSW 17 85070431 missense probably damaging 1.00
R6273:Prepl UTSW 17 85083268 missense probably benign 0.00
R7176:Prepl UTSW 17 85069026 missense probably benign 0.14
R7291:Prepl UTSW 17 85081240 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACAACATGCTGGACCCATG -3'
(R):5'- AAACTGATCCGTTTCATCGTTC -3'

Sequencing Primer
(F):5'- CATGGGTTGTTAACTCTACCTTAAG -3'
(R):5'- ATCGTTCATTCACATACCTCAGTAG -3'
Posted On2019-06-26