Incidental Mutation 'R7397:Rbm6'
ID573902
Institutional Source Beutler Lab
Gene Symbol Rbm6
Ensembl Gene ENSMUSG00000032582
Gene NameRNA binding motif protein 6
Synonymsg16, NY-LU-12, Def-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R7397 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107773559-107873237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107852519 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 310 (M310T)
Ref Sequence ENSEMBL: ENSMUSP00000138400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035201] [ENSMUST00000181986] [ENSMUST00000183032] [ENSMUST00000183035] [ENSMUST00000195866] [ENSMUST00000195883]
Predicted Effect probably benign
Transcript: ENSMUST00000035201
AA Change: M178T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035201
Gene: ENSMUSG00000032582
AA Change: M178T

DomainStartEndE-ValueType
internal_repeat_1 4 42 2.66e-5 PROSPERO
low complexity region 61 87 N/A INTRINSIC
internal_repeat_1 106 157 2.66e-5 PROSPERO
RRM 325 400 2.67e-2 SMART
Blast:ZnF_RBZ 406 430 2e-11 BLAST
RRM 522 601 1.32e-1 SMART
low complexity region 748 765 N/A INTRINSIC
ZnF_C2H2 818 843 4.34e0 SMART
low complexity region 864 876 N/A INTRINSIC
G_patch 912 958 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181986
Predicted Effect probably benign
Transcript: ENSMUST00000183032
AA Change: M310T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138400
Gene: ENSMUSG00000032582
AA Change: M310T

DomainStartEndE-ValueType
internal_repeat_1 43 119 2.42e-5 PROSPERO
internal_repeat_2 46 164 3.18e-5 PROSPERO
internal_repeat_1 121 189 2.42e-5 PROSPERO
low complexity region 193 219 N/A INTRINSIC
internal_repeat_2 224 319 3.18e-5 PROSPERO
RRM 457 532 2.67e-2 SMART
Blast:ZnF_RBZ 538 562 2e-9 BLAST
RRM 654 733 1.32e-1 SMART
low complexity region 880 897 N/A INTRINSIC
ZnF_C2H2 950 975 4.34e0 SMART
low complexity region 996 1008 N/A INTRINSIC
G_patch 1044 1090 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183035
Predicted Effect probably benign
Transcript: ENSMUST00000195866
Predicted Effect probably benign
Transcript: ENSMUST00000195883
SMART Domains Protein: ENSMUSP00000141953
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
Blast:ZnF_RBZ 24 48 9e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Foxc1 A G 13: 31,807,635 D143G probably damaging Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k1 G A 13: 111,755,208 A1171V probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nlrp10 A G 7: 108,924,692 L527P probably damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r1 T G 17: 65,837,791 I801S probably benign Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vmn2r91 G T 17: 18,135,798 V576L probably benign Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Rbm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Rbm6 APN 9 107788349 missense probably damaging 1.00
IGL01647:Rbm6 APN 9 107852882 missense probably benign 0.13
IGL01872:Rbm6 APN 9 107783715 missense probably damaging 0.99
IGL02402:Rbm6 APN 9 107852852 missense probably damaging 1.00
IGL03024:Rbm6 APN 9 107787368 missense probably damaging 0.97
IGL03025:Rbm6 APN 9 107774719 missense possibly damaging 0.76
FR4737:Rbm6 UTSW 9 107782755 frame shift probably null
PIT4402001:Rbm6 UTSW 9 107787850 missense probably damaging 1.00
R0511:Rbm6 UTSW 9 107847289 nonsense probably null
R1666:Rbm6 UTSW 9 107791856 missense probably benign 0.15
R1927:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R2173:Rbm6 UTSW 9 107852191 missense possibly damaging 0.79
R2262:Rbm6 UTSW 9 107791090 missense probably damaging 1.00
R2439:Rbm6 UTSW 9 107779597 missense probably damaging 1.00
R2566:Rbm6 UTSW 9 107791998 missense possibly damaging 0.60
R2878:Rbm6 UTSW 9 107852450 missense probably damaging 1.00
R4342:Rbm6 UTSW 9 107847247 intron probably benign
R4783:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R4785:Rbm6 UTSW 9 107787352 missense probably benign 0.06
R5205:Rbm6 UTSW 9 107788343 missense probably benign 0.08
R5253:Rbm6 UTSW 9 107852657 missense probably damaging 1.00
R5279:Rbm6 UTSW 9 107778014 missense probably benign 0.00
R5356:Rbm6 UTSW 9 107852666 missense probably damaging 1.00
R6289:Rbm6 UTSW 9 107777948 missense probably damaging 1.00
R6328:Rbm6 UTSW 9 107787259 missense probably benign 0.00
R6564:Rbm6 UTSW 9 107833498 missense probably damaging 1.00
R6887:Rbm6 UTSW 9 107852231 missense probably damaging 1.00
R6978:Rbm6 UTSW 9 107852575 intron probably null
R7139:Rbm6 UTSW 9 107853211 missense probably damaging 1.00
R7240:Rbm6 UTSW 9 107852896 missense probably damaging 1.00
R7330:Rbm6 UTSW 9 107791045 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GACCAGCATCTGAACTCTGTTG -3'
(R):5'- GGATACACCACATTCGGATTTC -3'

Sequencing Primer
(F):5'- GAACTCTGTTGTTCACCTCCAGAAAG -3'
(R):5'- CCACATTCGGATTTCAGAGGTAGAC -3'
Posted On2019-09-13