Incidental Mutation 'R0659:Lin28a'
ID61777
Institutional Source Beutler Lab
Gene Symbol Lin28a
Ensembl Gene ENSMUSG00000050966
Gene Namelin-28 homolog A (C. elegans)
SynonymsLin-28, Tex17, Lin28a, Lin28
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0659 (G1)
Quality Score127
Status Validated
Chromosome4
Chromosomal Location134003330-134018841 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 134008099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051674] [ENSMUST00000176113] [ENSMUST00000176292] [ENSMUST00000176897]
Predicted Effect probably benign
Transcript: ENSMUST00000051674
SMART Domains Protein: ENSMUSP00000050488
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
CSP 41 112 5.63e-14 SMART
ZnF_C2HC 138 154 1.91e-2 SMART
ZnF_C2HC 160 176 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176113
SMART Domains Protein: ENSMUSP00000135254
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.9e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176292
SMART Domains Protein: ENSMUSP00000135608
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.8e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176897
SMART Domains Protein: ENSMUSP00000135736
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 62 5.8e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth weight and postnatal lethality. In another report, mice homozygous for the same or an identical allele exhibit reduced premordial germ cells and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Lin28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lin28a APN 4 134008056 missense probably damaging 1.00
IGL01515:Lin28a APN 4 134018709 critical splice donor site probably null
IGL01725:Lin28a APN 4 134007930 nonsense probably null
R0730:Lin28a UTSW 4 134008008 missense probably damaging 1.00
R2129:Lin28a UTSW 4 134018154 missense probably benign 0.00
R3196:Lin28a UTSW 4 134007924 missense possibly damaging 0.80
R4998:Lin28a UTSW 4 134018717 missense possibly damaging 0.73
R5734:Lin28a UTSW 4 134007973 nonsense probably null
R6540:Lin28a UTSW 4 134018061 missense possibly damaging 0.85
R7012:Lin28a UTSW 4 134018729 missense probably damaging 1.00
R7226:Lin28a UTSW 4 134006308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGCTAAGAGGTTTTAAGCACCAC -3'
(R):5'- CTCAAACTGGGGTGACAGGTATGTG -3'

Sequencing Primer
(F):5'- CTAGGTAACCAGTTGAAGCTCCG -3'
(R):5'- gctgccatcctctgctc -3'
Posted On2013-07-30