Incidental Mutation 'R5734:Lin28a'
ID451578
Institutional Source Beutler Lab
Gene Symbol Lin28a
Ensembl Gene ENSMUSG00000050966
Gene Namelin-28 homolog A (C. elegans)
SynonymsLin-28, Tex17, Lin28a, Lin28
MMRRC Submission 043348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5734 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134003330-134018841 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134007973 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 67 (C67*)
Ref Sequence ENSEMBL: ENSMUSP00000135736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051674] [ENSMUST00000176113] [ENSMUST00000176292] [ENSMUST00000176897]
Predicted Effect probably null
Transcript: ENSMUST00000051674
AA Change: C117*
SMART Domains Protein: ENSMUSP00000050488
Gene: ENSMUSG00000050966
AA Change: C117*

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
CSP 41 112 5.63e-14 SMART
ZnF_C2HC 138 154 1.91e-2 SMART
ZnF_C2HC 160 176 4.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176113
AA Change: C37*
SMART Domains Protein: ENSMUSP00000135254
Gene: ENSMUSG00000050966
AA Change: C37*

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.9e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176292
AA Change: C37*
SMART Domains Protein: ENSMUSP00000135608
Gene: ENSMUSG00000050966
AA Change: C37*

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.8e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176897
AA Change: C67*
SMART Domains Protein: ENSMUSP00000135736
Gene: ENSMUSG00000050966
AA Change: C67*

DomainStartEndE-ValueType
Pfam:CSD 1 62 5.8e-15 PFAM
Meta Mutation Damage Score 0.61 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth weight and postnatal lethality. In another report, mice homozygous for the same or an identical allele exhibit reduced premordial germ cells and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,703,883 probably benign Het
4931429L15Rik A G 9: 46,304,005 probably benign Het
Abcc9 A G 6: 142,625,731 probably benign Het
Adamts2 G A 11: 50,788,667 G825R probably damaging Het
Adgre1 A T 17: 57,443,990 R555W probably benign Het
Apob T A 12: 7,988,781 V398D probably damaging Het
Arid4b A G 13: 14,160,271 N355S probably benign Het
Asb3 G T 11: 31,029,021 D143Y probably damaging Het
Birc6 G A 17: 74,618,424 probably benign Het
Cacna1a A G 8: 84,583,731 M1425V probably damaging Het
Capn9 A G 8: 124,605,844 E474G probably damaging Het
Capza2 T C 6: 17,660,765 S155P probably damaging Het
Ccdc125 A G 13: 100,687,114 N202S possibly damaging Het
Chrm5 T A 2: 112,480,100 T224S probably benign Het
Chtop C T 3: 90,502,115 probably null Het
Clip1 T C 5: 123,615,154 probably benign Het
Cyr61 A G 3: 145,648,268 C256R probably damaging Het
Dbx2 T C 15: 95,654,723 T14A possibly damaging Het
Dcaf8 T C 1: 172,172,911 V212A possibly damaging Het
Fam114a1 T C 5: 65,009,046 M240T probably damaging Het
Fat1 T C 8: 45,051,209 Y4580H probably damaging Het
Glipr1 G A 10: 111,985,793 R200* probably null Het
Gm6408 A T 5: 146,482,382 Y69F probably benign Het
Gpt2 T C 8: 85,523,256 S456P probably benign Het
Kat8 T C 7: 127,920,579 F225S probably benign Het
Lactb2 T A 1: 13,660,387 N22Y probably damaging Het
Marc2 T C 1: 184,832,589 E155G probably benign Het
Myoz3 G A 18: 60,579,471 T104M possibly damaging Het
Nek9 C T 12: 85,303,515 M928I probably benign Het
Nlrp9a G C 7: 26,570,640 A831P probably damaging Het
Nop53 T C 7: 15,945,962 probably null Het
Ofcc1 T A 13: 40,087,849 T728S probably damaging Het
Pabpc4l T A 3: 46,446,689 probably null Het
Rbm34 T C 8: 126,970,130 probably null Het
Robo2 C T 16: 74,352,784 C52Y probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Scn2a A G 2: 65,717,722 Y57C possibly damaging Het
Selp C T 1: 164,143,891 probably benign Het
Skp2 T C 15: 9,139,479 D43G possibly damaging Het
Smad5 T A 13: 56,723,804 S71T probably damaging Het
Sorcs1 G T 19: 50,182,775 H892N probably benign Het
Sox6 C T 7: 115,541,621 probably null Het
St3gal1 A T 15: 67,106,673 I333N probably damaging Het
Tex15 C A 8: 33,546,336 Q97K probably benign Het
Tnxb A T 17: 34,698,910 T2266S possibly damaging Het
Tpbgl C A 7: 99,625,742 G303C probably damaging Het
Trat1 A T 16: 48,734,941 S143T possibly damaging Het
Trpm8 T A 1: 88,355,280 V763E probably benign Het
Ttc21a G A 9: 119,966,666 D1189N probably benign Het
Usp7 T C 16: 8,701,981 N178D possibly damaging Het
Zfp217 T C 2: 170,119,144 D421G possibly damaging Het
Zfp382 T C 7: 30,134,430 F502S probably damaging Het
Other mutations in Lin28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lin28a APN 4 134008056 missense probably damaging 1.00
IGL01515:Lin28a APN 4 134018709 critical splice donor site probably null
IGL01725:Lin28a APN 4 134007930 nonsense probably null
R0659:Lin28a UTSW 4 134008099 splice site probably benign
R0730:Lin28a UTSW 4 134008008 missense probably damaging 1.00
R2129:Lin28a UTSW 4 134018154 missense probably benign 0.00
R3196:Lin28a UTSW 4 134007924 missense possibly damaging 0.80
R4998:Lin28a UTSW 4 134018717 missense possibly damaging 0.73
R6540:Lin28a UTSW 4 134018061 missense possibly damaging 0.85
R7012:Lin28a UTSW 4 134018729 missense probably damaging 1.00
R7226:Lin28a UTSW 4 134006308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGCGTAAATTATCTTTGGC -3'
(R):5'- AGGTATGTGCTGCCATCCTC -3'

Sequencing Primer
(F):5'- ATCTTTGGCAATGGGATCCAAG -3'
(R):5'- GAGTCCATTTTCCCATCTGTGAG -3'
Posted On2017-01-03