Incidental Mutation 'R0717:Mbd1'
ID 62888
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Name methyl-CpG binding domain protein 1
Synonyms PCM1, Cxxc3
MMRRC Submission 038899-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0717 (G1)
Quality Score 187
Status Not validated
Chromosome 18
Chromosomal Location 74400676-74415803 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74406668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 137 (A137V)
Ref Sequence ENSEMBL: ENSMUSP00000153428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000097530
AA Change: A137V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561
AA Change: A137V

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224047
AA Change: A137V

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224159
Predicted Effect unknown
Transcript: ENSMUST00000224332
AA Change: A27V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224907
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,084,970 (GRCm39) H37Y possibly damaging Het
Anxa11 G A 14: 25,875,213 (GRCm39) probably null Het
Arhgap33 G T 7: 30,227,774 (GRCm39) A475E probably damaging Het
Cacna1s A G 1: 136,026,029 (GRCm39) N811S probably damaging Het
Cadm1 T A 9: 47,721,366 (GRCm39) M252K probably benign Het
Cars1 T C 7: 143,138,492 (GRCm39) R149G probably damaging Het
Ccdc125 A T 13: 100,826,866 (GRCm39) D241V probably damaging Het
Col12a1 G A 9: 79,519,701 (GRCm39) P2836S probably damaging Het
Grid2 T A 6: 64,643,259 (GRCm39) I1007K possibly damaging Het
Hdhd2 G A 18: 77,038,900 (GRCm39) A28T possibly damaging Het
Hivep1 A T 13: 42,308,422 (GRCm39) T221S possibly damaging Het
Lztr1 A G 16: 17,333,912 (GRCm39) probably null Het
Myh15 T C 16: 48,963,356 (GRCm39) V1099A probably benign Het
Nox4 C A 7: 86,954,098 (GRCm39) Y134* probably null Het
Or5k14 A G 16: 58,693,133 (GRCm39) C127R probably damaging Het
Pde1c T A 6: 56,099,997 (GRCm39) N681I probably damaging Het
Pon1 A G 6: 5,193,674 (GRCm39) probably null Het
Prokr2 T C 2: 132,223,254 (GRCm39) D96G probably damaging Het
Sdk2 C A 11: 113,723,152 (GRCm39) V1280F probably damaging Het
Sim1 A G 10: 50,785,924 (GRCm39) D259G probably damaging Het
Tcaf1 A T 6: 42,655,599 (GRCm39) M459K probably benign Het
Tmem201 T A 4: 149,803,267 (GRCm39) N534Y probably damaging Het
Tspan9 A T 6: 127,943,343 (GRCm39) probably null Het
Uba7 A T 9: 107,854,416 (GRCm39) T252S probably benign Het
Ube2e2 T C 14: 18,888,435 (GRCm38) T3A probably benign Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74,408,310 (GRCm39) missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74,402,614 (GRCm39) unclassified probably benign
IGL02213:Mbd1 APN 18 74,408,453 (GRCm39) missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74,409,993 (GRCm39) missense probably benign 0.00
IGL02596:Mbd1 APN 18 74,409,868 (GRCm39) splice site probably benign
IGL02944:Mbd1 APN 18 74,410,481 (GRCm39) missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74,408,498 (GRCm39) splice site probably benign
IGL03200:Mbd1 APN 18 74,409,502 (GRCm39) missense probably benign 0.02
IGL03247:Mbd1 APN 18 74,407,825 (GRCm39) nonsense probably null
IGL03340:Mbd1 APN 18 74,407,553 (GRCm39) missense probably benign 0.00
Shortbread UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
FR4737:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
P0016:Mbd1 UTSW 18 74,407,609 (GRCm39) nonsense probably null
R0385:Mbd1 UTSW 18 74,406,312 (GRCm39) frame shift probably null
R0630:Mbd1 UTSW 18 74,409,798 (GRCm39) splice site probably benign
R1084:Mbd1 UTSW 18 74,402,603 (GRCm39) missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74,402,557 (GRCm39) missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74,408,490 (GRCm39) critical splice donor site probably null
R2065:Mbd1 UTSW 18 74,409,955 (GRCm39) missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74,410,449 (GRCm39) missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74,409,548 (GRCm39) missense probably benign 0.42
R2697:Mbd1 UTSW 18 74,406,688 (GRCm39) missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74,410,438 (GRCm39) missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74,407,487 (GRCm39) missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74,402,597 (GRCm39) missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74,402,581 (GRCm39) missense probably benign 0.03
R5860:Mbd1 UTSW 18 74,409,768 (GRCm39) nonsense probably null
R6431:Mbd1 UTSW 18 74,406,762 (GRCm39) splice site probably null
R6734:Mbd1 UTSW 18 74,409,114 (GRCm39) missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74,406,645 (GRCm39)
R7363:Mbd1 UTSW 18 74,406,357 (GRCm39) missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74,407,520 (GRCm39) missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74,407,804 (GRCm39) missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
R8960:Mbd1 UTSW 18 74,406,890 (GRCm39) critical splice donor site probably null
R9161:Mbd1 UTSW 18 74,407,792 (GRCm39) missense probably benign 0.01
R9774:Mbd1 UTSW 18 74,408,274 (GRCm39) missense probably benign
RF005:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF011:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF058:Mbd1 UTSW 18 74,406,680 (GRCm39) frame shift probably null
Z1177:Mbd1 UTSW 18 74,410,010 (GRCm39) missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- AAGGCACCTTATGCCATCCCATTC -3'
(R):5'- ATAACCTCCAGCTTAGCCTGGCAC -3'

Sequencing Primer
(F):5'- CAATTGTGTCACATGGCACC -3'
(R):5'- ACAGTGTGGCCTGTCTAATTC -3'
Posted On 2013-07-30