Incidental Mutation 'R4348:Mbd1'
ID 500637
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Name methyl-CpG binding domain protein 1
Synonyms PCM1, Cxxc3
MMRRC Submission 041103-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4348 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 74400676-74415803 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74407487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 199 (R199L)
Ref Sequence ENSEMBL: ENSMUSP00000153428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000097530
AA Change: R199L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561
AA Change: R199L

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224047
AA Change: R199L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224159
Predicted Effect probably damaging
Transcript: ENSMUST00000224332
AA Change: R89L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224907
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Aass A G 6: 23,113,738 (GRCm39) F235L probably benign Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Adcy6 A T 15: 98,502,041 (GRCm39) V191E probably benign Het
Cngb3 G A 4: 19,396,688 (GRCm39) R347Q probably damaging Het
Cntnap4 T A 8: 113,480,554 (GRCm39) C334S probably damaging Het
D7Ertd443e ACCTAGGAGGTCCT ACCT 7: 133,950,682 (GRCm39) probably null Het
Dnah12 T A 14: 26,536,498 (GRCm39) M2138K possibly damaging Het
Ebf2 T C 14: 67,476,871 (GRCm39) I138T probably damaging Het
Ect2l A G 10: 18,012,736 (GRCm39) S784P probably damaging Het
Emilin2 T C 17: 71,587,726 (GRCm39) M129V probably benign Het
Enah A T 1: 181,749,985 (GRCm39) S266T possibly damaging Het
Fhip1b A G 7: 105,034,556 (GRCm39) V422A probably damaging Het
Garem2 G A 5: 30,310,366 (GRCm39) R26H possibly damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Gpatch11 T C 17: 79,148,446 (GRCm39) L128P probably damaging Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Kcns3 T C 12: 11,141,382 (GRCm39) N439S possibly damaging Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Mbd5 T A 2: 49,146,339 (GRCm39) M183K probably benign Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Nckap1l A G 15: 103,395,246 (GRCm39) T909A probably damaging Het
Ntrk2 A G 13: 59,026,073 (GRCm39) K464E probably damaging Het
Orc1 C T 4: 108,450,649 (GRCm39) T127I probably damaging Het
Pcdh17 T C 14: 84,685,060 (GRCm39) I509T probably damaging Het
Pcsk7 G A 9: 45,830,646 (GRCm39) A475T probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Prdm16 A G 4: 154,561,124 (GRCm39) V136A probably benign Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Ptpn13 T A 5: 103,717,592 (GRCm39) S1879R probably damaging Het
Rasgrp3 A T 17: 75,818,975 (GRCm39) Q388L probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rnf38 A T 4: 44,149,100 (GRCm39) N82K possibly damaging Het
Smco3 T A 6: 136,808,692 (GRCm39) T61S possibly damaging Het
Ssx2ip T C 3: 146,138,245 (GRCm39) V364A probably benign Het
Ttn A G 2: 76,595,109 (GRCm39) I20347T possibly damaging Het
Vmn2r120 A T 17: 57,829,466 (GRCm39) F477Y possibly damaging Het
Wee1 A G 7: 109,730,165 (GRCm39) H423R probably damaging Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74,408,310 (GRCm39) missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74,402,614 (GRCm39) unclassified probably benign
IGL02213:Mbd1 APN 18 74,408,453 (GRCm39) missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74,409,993 (GRCm39) missense probably benign 0.00
IGL02596:Mbd1 APN 18 74,409,868 (GRCm39) splice site probably benign
IGL02944:Mbd1 APN 18 74,410,481 (GRCm39) missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74,408,498 (GRCm39) splice site probably benign
IGL03200:Mbd1 APN 18 74,409,502 (GRCm39) missense probably benign 0.02
IGL03247:Mbd1 APN 18 74,407,825 (GRCm39) nonsense probably null
IGL03340:Mbd1 APN 18 74,407,553 (GRCm39) missense probably benign 0.00
Shortbread UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
FR4737:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
P0016:Mbd1 UTSW 18 74,407,609 (GRCm39) nonsense probably null
R0385:Mbd1 UTSW 18 74,406,312 (GRCm39) frame shift probably null
R0630:Mbd1 UTSW 18 74,409,798 (GRCm39) splice site probably benign
R0717:Mbd1 UTSW 18 74,406,668 (GRCm39) missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74,402,603 (GRCm39) missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74,402,557 (GRCm39) missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74,408,490 (GRCm39) critical splice donor site probably null
R2065:Mbd1 UTSW 18 74,409,955 (GRCm39) missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74,410,449 (GRCm39) missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74,409,548 (GRCm39) missense probably benign 0.42
R2697:Mbd1 UTSW 18 74,406,688 (GRCm39) missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74,410,438 (GRCm39) missense possibly damaging 0.94
R4664:Mbd1 UTSW 18 74,402,597 (GRCm39) missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74,402,581 (GRCm39) missense probably benign 0.03
R5860:Mbd1 UTSW 18 74,409,768 (GRCm39) nonsense probably null
R6431:Mbd1 UTSW 18 74,406,762 (GRCm39) splice site probably null
R6734:Mbd1 UTSW 18 74,409,114 (GRCm39) missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74,406,645 (GRCm39)
R7363:Mbd1 UTSW 18 74,406,357 (GRCm39) missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74,407,520 (GRCm39) missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74,407,804 (GRCm39) missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
R8960:Mbd1 UTSW 18 74,406,890 (GRCm39) critical splice donor site probably null
R9161:Mbd1 UTSW 18 74,407,792 (GRCm39) missense probably benign 0.01
R9774:Mbd1 UTSW 18 74,408,274 (GRCm39) missense probably benign
RF005:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF011:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF058:Mbd1 UTSW 18 74,406,680 (GRCm39) frame shift probably null
Z1177:Mbd1 UTSW 18 74,410,010 (GRCm39) missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- TTTAACAGAGCCCTTCCTTGTAGG -3'
(R):5'- TGTGATGTCTGGAGTCAGCC -3'

Sequencing Primer
(F):5'- CTTCCTTGTAGGGAACATCATAGCG -3'
(R):5'- AGTCAGCCGGGGACTGAG -3'
Posted On 2017-12-01