Incidental Mutation 'R0095:Fam84b'
ID64041
Institutional Source Beutler Lab
Gene Symbol Fam84b
Ensembl Gene ENSMUSG00000072568
Gene Namefamily with sequence similarity 84, member B
SynonymsD330050I23Rik
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0095 (G1)
Quality Score84
Status Not validated
Chromosome15
Chromosomal Location60818994-60853778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60823576 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 107 (Y107C)
Ref Sequence ENSEMBL: ENSMUSP00000098200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100635]
Predicted Effect probably damaging
Transcript: ENSMUST00000100635
AA Change: Y107C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098200
Gene: ENSMUSG00000072568
AA Change: Y107C

DomainStartEndE-ValueType
low complexity region 47 52 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
Pfam:LRAT 114 163 3.6e-9 PFAM
Pfam:LRAT 147 214 2.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192865
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Fam84b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Fam84b APN 15 60823118 missense probably damaging 0.97
IGL02072:Fam84b APN 15 60823453 missense probably damaging 0.99
IGL02588:Fam84b APN 15 60823150 missense probably damaging 0.99
IGL02823:Fam84b APN 15 60823123 missense probably damaging 0.97
R0276:Fam84b UTSW 15 60823674 nonsense probably null
R0285:Fam84b UTSW 15 60822967 missense probably benign 0.02
R1538:Fam84b UTSW 15 60823649 missense probably damaging 1.00
R3162:Fam84b UTSW 15 60823447 missense probably damaging 1.00
R4664:Fam84b UTSW 15 60823629 missense probably benign 0.00
R4801:Fam84b UTSW 15 60823944 start gained probably benign
R4802:Fam84b UTSW 15 60823944 start gained probably benign
R6125:Fam84b UTSW 15 60823297 missense probably damaging 1.00
R6254:Fam84b UTSW 15 60823801 missense probably damaging 1.00
R6950:Fam84b UTSW 15 60823714 missense probably benign 0.01
R6957:Fam84b UTSW 15 60823085 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCGAGAGCTGAATCTGCAAAC -3'
(R):5'- TTTCTCCAATGACGACGAGGATGTG -3'

Sequencing Primer
(F):5'- TGTAGCGATACAGATCGTTGACC -3'
(R):5'- AGGATGTGGAACCTCAGCC -3'
Posted On2013-08-06