Incidental Mutation 'R0737:Gm6614'
ID70509
Institutional Source Beutler Lab
Gene Symbol Gm6614
Ensembl Gene ENSMUSG00000079263
Gene Namepredicted gene 6614
Synonyms
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141971845-142011414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142003428 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 74 (A74E)
Ref Sequence ENSEMBL: ENSMUSP00000137696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111832
AA Change: A74E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263
AA Change: A74E

DomainStartEndE-ValueType
Pfam:OATP 1 577 2.5e-156 PFAM
Pfam:MFS_1 125 402 1e-23 PFAM
Pfam:Kazal_2 425 466 4.1e-9 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181628
AA Change: A94E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263
AA Change: A94E

DomainStartEndE-ValueType
Pfam:OATP 19 598 2.8e-187 PFAM
Pfam:MFS_1 145 422 8e-24 PFAM
Pfam:Kazal_2 445 486 1.1e-7 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181791
AA Change: A74E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263
AA Change: A74E

DomainStartEndE-ValueType
Pfam:OATP 1 578 2.3e-186 PFAM
Pfam:MFS_1 125 402 8.6e-24 PFAM
Pfam:Kazal_2 425 466 1.4e-7 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Gm6614
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Gm6614 APN 6 141990408 missense probably benign 0.00
IGL01548:Gm6614 APN 6 141992512 missense possibly damaging 0.82
IGL01552:Gm6614 APN 6 141987706 missense possibly damaging 0.54
IGL02207:Gm6614 APN 6 141990432 missense possibly damaging 0.80
IGL02227:Gm6614 APN 6 141993675 nonsense probably null
IGL02547:Gm6614 APN 6 141990390 missense probably damaging 0.99
IGL02678:Gm6614 APN 6 142008718 missense probably damaging 1.00
IGL02695:Gm6614 APN 6 141987760 missense probably damaging 1.00
IGL02851:Gm6614 APN 6 142003471 missense probably damaging 1.00
IGL02881:Gm6614 APN 6 141972243 missense probably benign 0.00
IGL02898:Gm6614 APN 6 141994297 missense probably benign 0.01
IGL03036:Gm6614 APN 6 142008607 missense possibly damaging 0.69
IGL03065:Gm6614 APN 6 141992502 missense probably damaging 0.99
IGL03300:Gm6614 APN 6 141994806 missense probably damaging 0.96
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0149:Gm6614 UTSW 6 141992477 missense probably benign 0.01
R0270:Gm6614 UTSW 6 141972411 missense possibly damaging 0.88
R0360:Gm6614 UTSW 6 141982327 splice site probably benign
R0420:Gm6614 UTSW 6 141985477 splice site probably benign
R1344:Gm6614 UTSW 6 141985618 missense probably damaging 1.00
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1590:Gm6614 UTSW 6 141980872 missense probably benign 0.00
R1666:Gm6614 UTSW 6 141982049 splice site probably null
R1669:Gm6614 UTSW 6 141987689 missense probably benign 0.39
R1862:Gm6614 UTSW 6 142003423 missense possibly damaging 0.95
R1882:Gm6614 UTSW 6 141993637 critical splice donor site probably null
R2134:Gm6614 UTSW 6 141980978 missense probably damaging 1.00
R2155:Gm6614 UTSW 6 141980944 missense probably damaging 1.00
R2163:Gm6614 UTSW 6 141980938 missense possibly damaging 0.55
R2227:Gm6614 UTSW 6 141992361 missense possibly damaging 0.67
R2382:Gm6614 UTSW 6 141990480 missense probably benign 0.00
R3773:Gm6614 UTSW 6 141972335 missense probably benign 0.17
R4869:Gm6614 UTSW 6 141987766 missense probably damaging 1.00
R4975:Gm6614 UTSW 6 141980873 missense probably benign 0.30
R5061:Gm6614 UTSW 6 142008688 missense probably benign 0.03
R5079:Gm6614 UTSW 6 141972347 missense probably benign 0.00
R5312:Gm6614 UTSW 6 141972332 missense probably benign 0.00
R5691:Gm6614 UTSW 6 141994855 nonsense probably null
R5874:Gm6614 UTSW 6 141972235 missense probably benign 0.00
R5945:Gm6614 UTSW 6 141994282 missense probably damaging 1.00
R6478:Gm6614 UTSW 6 141993642 missense possibly damaging 0.93
R7305:Gm6614 UTSW 6 141992494 missense probably damaging 1.00
R7325:Gm6614 UTSW 6 141989225 missense probably damaging 0.98
R7427:Gm6614 UTSW 6 142003508 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCACTGATTGTGGTGGCAAAGGAC -3'
(R):5'- CCATGTTGAACAACGAAGGTGGC -3'

Sequencing Primer
(F):5'- TGGTGGCAAAGGACTTACTC -3'
(R):5'- TCTATACAATCCCAAGGGATGGATG -3'
Posted On2013-09-30