Mutagenetix > Incidental Mutation

Incidental Mutation 'R0808:Or8h8'

76320

Institutional Source

Beutler Lab

Gene Symbol

Or8h8

Ensembl Gene

ENSMUSG00000075169

Gene Name

olfactory receptor family 8 subfamily H member 8

Synonyms

MOR206-1, Olfr1098, GA_x6K02T2Q125-48410458-48409511

MMRRC Submission

038988-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R0808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86752927-86753874 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86753795 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 27 (L27H)

Ref Sequence

ENSEMBL: ENSMUSP00000107200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]

AlphaFold

A2AVB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000099872
AA Change: L27H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: L27H

Domain	Start	End	E-Value	Type
Pfam:7tm_1	41	290	7e-29	PFAM
Pfam:7tm_4	140	283	3.3e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111574
AA Change: L27H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: L27H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.8e-52	PFAM
Pfam:7tm_1	41	309	8.1e-20	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 1 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Mup21	G	A	4: 62,066,478 (GRCm39)	R141*	probably null	Het

Other mutations in Or8h8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Or8h8	APN	2	86,753,293 (GRCm39)	missense	probably benign
IGL02547:Or8h8	APN	2	86,753,372 (GRCm39)	missense	probably damaging	1.00
IGL02881:Or8h8	APN	2	86,753,057 (GRCm39)	missense	possibly damaging	0.94
IGL03073:Or8h8	APN	2	86,753,697 (GRCm39)	missense	probably damaging	1.00
R0117:Or8h8	UTSW	2	86,753,214 (GRCm39)	missense	probably damaging	1.00
R1061:Or8h8	UTSW	2	86,753,126 (GRCm39)	missense	possibly damaging	0.93
R1471:Or8h8	UTSW	2	86,752,922 (GRCm39)	splice site	probably null
R1571:Or8h8	UTSW	2	86,753,789 (GRCm39)	missense	probably benign	0.01
R1680:Or8h8	UTSW	2	86,753,505 (GRCm39)	missense	probably benign	0.10
R2341:Or8h8	UTSW	2	86,752,982 (GRCm39)	missense	possibly damaging	0.63
R2368:Or8h8	UTSW	2	86,753,451 (GRCm39)	missense	probably benign
R3158:Or8h8	UTSW	2	86,752,950 (GRCm39)	missense	probably benign
R3425:Or8h8	UTSW	2	86,752,950 (GRCm39)	missense	probably benign
R3499:Or8h8	UTSW	2	86,753,373 (GRCm39)	missense	possibly damaging	0.94
R4156:Or8h8	UTSW	2	86,753,222 (GRCm39)	missense	probably damaging	1.00
R4526:Or8h8	UTSW	2	86,753,339 (GRCm39)	missense	possibly damaging	0.90
R5743:Or8h8	UTSW	2	86,753,549 (GRCm39)	missense	probably benign	0.01
R5942:Or8h8	UTSW	2	86,753,750 (GRCm39)	missense	probably damaging	1.00
R6372:Or8h8	UTSW	2	86,753,499 (GRCm39)	missense	probably damaging	1.00
R6409:Or8h8	UTSW	2	86,753,515 (GRCm39)	nonsense	probably null
R6517:Or8h8	UTSW	2	86,753,441 (GRCm39)	missense	probably benign	0.05
R6661:Or8h8	UTSW	2	86,753,492 (GRCm39)	missense	probably benign	0.02
R7075:Or8h8	UTSW	2	86,752,990 (GRCm39)	missense	possibly damaging	0.88
R7166:Or8h8	UTSW	2	86,753,092 (GRCm39)	missense	probably damaging	0.97
R8058:Or8h8	UTSW	2	86,753,151 (GRCm39)	missense	probably benign	0.32
R8234:Or8h8	UTSW	2	86,753,313 (GRCm39)	missense	probably damaging	1.00
R9115:Or8h8	UTSW	2	86,752,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTGAAGCATCCCATGAAGGAA -3'
(R):5'- GGGGCCAAAATCTTATCATGTACTCATGAA -3'

Sequencing Primer
(F):5'- AGGTCAGCGTATTCTGTAAGG -3'
(R):5'- CTCATGAACTCAACTGTAATACTTCC -3'

Posted On

2013-10-16