Incidental Mutation 'R0799:Cct3'
ID76514
Institutional Source Beutler Lab
Gene Symbol Cct3
Ensembl Gene ENSMUSG00000001416
Gene Namechaperonin containing Tcp1, subunit 3 (gamma)
SynonymsCctg, Tcp1-rs3, TriC-P5
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88297116-88321767 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 88299345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000010682] [ENSMUST00000107556] [ENSMUST00000164166] [ENSMUST00000168062]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001452
AA Change: Q12L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416
AA Change: Q12L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000010682
Predicted Effect probably null
Transcript: ENSMUST00000107556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123536
Predicted Effect probably benign
Transcript: ENSMUST00000163735
SMART Domains Protein: ENSMUSP00000130616
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 2 115 4.7e-22 PFAM
Pfam:Cpn60_TCP1 106 306 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164166
AA Change: Q12L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416
AA Change: Q12L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167718
Predicted Effect possibly damaging
Transcript: ENSMUST00000168062
AA Change: Q12L

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131113
Gene: ENSMUSG00000001416
AA Change: Q12L

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 520 2.3e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193666
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants have been characterized for this gene. In addition, a pseudogene of this gene has been found on chromosome 8. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Cct3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0454:Cct3 UTSW 3 88302866 critical splice donor site probably null
R0883:Cct3 UTSW 3 88313557 missense probably damaging 1.00
R1202:Cct3 UTSW 3 88318528 critical splice donor site probably null
R3889:Cct3 UTSW 3 88321027 missense probably benign 0.00
R4766:Cct3 UTSW 3 88311785 nonsense probably null
R5089:Cct3 UTSW 3 88300843 missense probably damaging 1.00
R5224:Cct3 UTSW 3 88297225 utr 5 prime probably benign
R5263:Cct3 UTSW 3 88321365 critical splice donor site probably null
R5772:Cct3 UTSW 3 88300967 missense probably damaging 1.00
R6026:Cct3 UTSW 3 88311722 missense possibly damaging 0.90
R7230:Cct3 UTSW 3 88313260 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGTAGGATGGCTCAACAGGTTTAAAA -3'
(R):5'- CTTCCTGTATCACCACCAGGGAAATG -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgtttgtttgtttg -3'
(R):5'- AAAAGCAAGTTTTCCTCTGCTC -3'
Posted On2013-10-16