Incidental Mutation 'R1099:Olfr373'
ID97909
Institutional Source Beutler Lab
Gene Symbol Olfr373
Ensembl Gene ENSMUSG00000061561
Gene Nameolfactory receptor 373
SynonymsMOR282-2, GA_x6K02T2NUPS-231686-232630, MOR282-1
MMRRC Submission 039173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1099 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72083177-72103084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72100659 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 300 (S300T)
Ref Sequence ENSEMBL: ENSMUSP00000149452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074540] [ENSMUST00000213940] [ENSMUST00000215198]
Predicted Effect probably benign
Transcript: ENSMUST00000074540
AA Change: S300T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074128
Gene: ENSMUSG00000061561
AA Change: S300T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 253 6.5e-8 PFAM
Pfam:7tm_1 41 290 4.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213940
AA Change: S300T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000215198
AA Change: S300T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abca7 G T 10: 80,013,743 E1921* probably null Het
Acnat2 G A 4: 49,380,484 T298I probably benign Het
Agbl4 T C 4: 110,955,663 probably null Het
Angpt2 T A 8: 18,699,133 T323S probably damaging Het
Ano2 A G 6: 125,807,847 K299R probably damaging Het
Armc2 G T 10: 41,917,187 Q814K probably benign Het
Atp9b A C 18: 80,858,626 I263S probably damaging Het
Cadps2 A G 6: 23,599,479 I276T probably damaging Het
Casp12 T A 9: 5,352,204 H135Q probably benign Het
Ccdc180 A G 4: 45,914,225 I621V probably benign Het
Cd160 G A 3: 96,805,840 A36V probably damaging Het
Ctcfl A T 2: 173,112,360 C315S probably damaging Het
Egflam A G 15: 7,252,422 V411A probably benign Het
Ezh1 T C 11: 101,193,808 probably null Het
Fam171a1 T A 2: 3,225,317 S371T probably benign Het
Hspbap1 T G 16: 35,824,944 F333C probably damaging Het
Ky G C 9: 102,537,724 W278C probably damaging Het
Lrig3 T A 10: 126,007,014 probably null Het
Map3k6 A T 4: 133,247,128 S580C probably damaging Het
Mark2 T C 19: 7,277,425 T219A probably benign Het
Mbd5 A G 2: 49,258,144 I789V probably benign Het
Myo18a T A 11: 77,818,901 probably null Het
Nos1 A G 5: 117,923,395 T929A probably damaging Het
Olfr434 T C 6: 43,217,624 F237S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Palmd T C 3: 116,923,225 N541S possibly damaging Het
Pdzd2 A G 15: 12,373,087 S2321P probably damaging Het
Prdm8 T G 5: 98,183,502 I71S probably damaging Het
Prkg1 A C 19: 30,571,612 S654R probably benign Het
Psmf1 A T 2: 151,718,670 H260Q probably damaging Het
Rp1 A T 1: 4,352,290 I179N possibly damaging Het
Rreb1 A G 13: 37,948,891 K1681E probably benign Het
Rtn1 A T 12: 72,304,467 probably null Het
Scaf4 T A 16: 90,263,098 I37F unknown Het
Sema4c A G 1: 36,552,110 S383P probably damaging Het
Shc4 G T 2: 125,722,844 D178E probably benign Het
Slc2a5 A G 4: 150,142,179 N366S probably benign Het
Slc6a3 A G 13: 73,567,641 N465S probably benign Het
Tbc1d9b C A 11: 50,146,308 D261E probably benign Het
Tdrd3 A T 14: 87,487,239 T359S probably damaging Het
Thap3 T C 4: 151,983,331 M97V probably benign Het
Thg1l T A 11: 45,954,161 Q88L possibly damaging Het
Tjp3 T C 10: 81,273,823 T849A probably benign Het
Tomm70a G T 16: 57,142,817 D400Y probably damaging Het
Trak2 T C 1: 58,921,841 I177V probably benign Het
Trim66 T C 7: 109,475,454 I533M probably benign Het
Ush2a T A 1: 188,648,348 Y2285N probably benign Het
Ush2a C T 1: 188,864,639 P3859S probably damaging Het
Other mutations in Olfr373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr373 APN 8 72100512 missense probably damaging 1.00
IGL02440:Olfr373 APN 8 72100530 missense probably damaging 1.00
IGL03403:Olfr373 APN 8 72100497 missense probably benign 0.00
R1418:Olfr373 UTSW 8 72100387 missense probably damaging 1.00
R1452:Olfr373 UTSW 8 72100176 nonsense probably null
R1621:Olfr373 UTSW 8 72100129 missense probably damaging 1.00
R2021:Olfr373 UTSW 8 72100086 missense possibly damaging 0.90
R4230:Olfr373 UTSW 8 72100344 missense probably damaging 1.00
R4290:Olfr373 UTSW 8 72099768 missense probably benign
R5035:Olfr373 UTSW 8 72100078 missense probably damaging 1.00
R6884:Olfr373 UTSW 8 72100501 missense probably benign 0.26
R6909:Olfr373 UTSW 8 72100528 missense possibly damaging 0.95
Z1088:Olfr373 UTSW 8 72100517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGTTGGCGCTCTCCATCTCTG -3'
(R):5'- CTGAAAGCCTGAGGTAACCTTCCTG -3'

Sequencing Primer
(F):5'- GAGCTGTCCTGCTCATGC -3'
(R):5'- caggcatccaccccaag -3'
Posted On2014-01-05