Incidental Mutation 'R4230:Olfr373'
ID320794
Institutional Source Beutler Lab
Gene Symbol Olfr373
Ensembl Gene ENSMUSG00000061561
Gene Nameolfactory receptor 373
SynonymsMOR282-2, GA_x6K02T2NUPS-231686-232630, MOR282-1
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72083177-72103084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72100344 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 195 (Y195H)
Ref Sequence ENSEMBL: ENSMUSP00000149452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074540] [ENSMUST00000213940] [ENSMUST00000215198]
Predicted Effect probably damaging
Transcript: ENSMUST00000074540
AA Change: Y195H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074128
Gene: ENSMUSG00000061561
AA Change: Y195H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 253 6.5e-8 PFAM
Pfam:7tm_1 41 290 4.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213940
AA Change: Y195H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215198
AA Change: Y195H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Olfr373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr373 APN 8 72100512 missense probably damaging 1.00
IGL02440:Olfr373 APN 8 72100530 missense probably damaging 1.00
IGL03403:Olfr373 APN 8 72100497 missense probably benign 0.00
R1099:Olfr373 UTSW 8 72100659 missense probably benign 0.00
R1418:Olfr373 UTSW 8 72100387 missense probably damaging 1.00
R1452:Olfr373 UTSW 8 72100176 nonsense probably null
R1621:Olfr373 UTSW 8 72100129 missense probably damaging 1.00
R2021:Olfr373 UTSW 8 72100086 missense possibly damaging 0.90
R4290:Olfr373 UTSW 8 72099768 missense probably benign
R5035:Olfr373 UTSW 8 72100078 missense probably damaging 1.00
R6884:Olfr373 UTSW 8 72100501 missense probably benign 0.26
R6909:Olfr373 UTSW 8 72100528 missense possibly damaging 0.95
Z1088:Olfr373 UTSW 8 72100517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTACCAGGTGCTCATGAGAAAC -3'
(R):5'- GCTGCCTGGGACCATGTATATG -3'

Sequencing Primer
(F):5'- TGCTCATGAGAAACCAAGTGTGTC -3'
(R):5'- CTGCCTGGGACCATGTATATGAATAC -3'
Posted On2015-06-12