Incidental Mutation 'R1022:Igfals'
ID98810
Institutional Source Beutler Lab
Gene Symbol Igfals
Ensembl Gene ENSMUSG00000046070
Gene Nameinsulin-like growth factor binding protein, acid labile subunit
SynonymsALS, Albs
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1022 (G1)
Quality Score136
Status Not validated
Chromosome17
Chromosomal Location24878770-24882008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24880483 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 183 (V183M)
Ref Sequence ENSEMBL: ENSMUSP00000060169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050714
AA Change: V183M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: V183M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Igfals
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Igfals APN 17 24881660 missense probably benign 0.08
IGL01796:Igfals APN 17 24880082 missense probably damaging 0.96
IGL02448:Igfals APN 17 24880187 missense probably damaging 1.00
R1024:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1127:Igfals UTSW 17 24880481 missense probably damaging 1.00
R1653:Igfals UTSW 17 24881078 missense probably benign 0.00
R1827:Igfals UTSW 17 24880304 missense probably benign 0.20
R3872:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3873:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3874:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R4278:Igfals UTSW 17 24881217 missense probably benign 0.01
R5360:Igfals UTSW 17 24880093 missense probably benign 0.00
R5417:Igfals UTSW 17 24880316 missense probably damaging 1.00
R5654:Igfals UTSW 17 24881465 missense probably benign 0.23
R6261:Igfals UTSW 17 24881365 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TACCATCTGCACCTGGAACGGAAC -3'
(R):5'- TTGTGTGACAGGTCCAGCCAAC -3'

Sequencing Primer
(F):5'- CTGGAACGGAACCTGCTC -3'
(R):5'- AACGCAGTGCCTTCATGC -3'
Posted On2014-01-09