Allele | Tigrou | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 105,132,012 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Atp7a | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ATPase, Cu++ transporting, alpha polypeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Menkes protein, MNK, br | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 105,070,882-105,168,532 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013] PHENOTYPE: Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Glutamic Acid changed to Valine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q64430 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000058840 Gene: ENSMUSG00000033792 AA Change: E470V
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000109186 Gene: ENSMUSG00000033792 AA Change: E469V
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly essential (E-score: 0.734) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | X-linked Dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(104) : Targeted(2) Gene trapped(63) Spontaneous(24) Chemically induced(9) Radiation induced(8) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | X-linked Dominant | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | none | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2008-06-02 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The Tigrou mutation was originally discovered in a G1 female. Heterozygous Tigrou females are black with brown stripes on the back, belly and face (Figure 1A) (1). These stripes do not appear to cross the midline. The strength of the phenotype increases with age, the brown coat color becoming lighter with time. Closer examination of newborn mutant females shows that the skin itself is lighter in color at the sites destined to become covered with brown hair. The Tigrou mutation results in some prenatal male lethality (1). Surviving Tigrou males are entirely white except for darker pigmentation at the extremities, similar to a thermolabile mutation in the melanogenic enzyme tyrosinase (see the record for ghost) (Figure 1B). Such males die within 20 days after birth. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
The Tigrou mutation corresponds to a G to T transversion at position 1485 of the Atp7a transcript, in exon 5 of 23 total exons.
1470 TTGCCCTCAAGTAATGAGCTAGAAAATGTGATG
464 -L--P--S--S--N--E--L--E--N--V--M-
The mutated nucleotide is indicated in red lettering, and changes the glutamic acid at codon 469 to a stop codon.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Please see the record for Tigrou-like for information about Atp7a.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The Tigrou mutation results in protein truncation prior to the fifth N-terminal copper-binding domain. This would result in a severely truncated protein missing all of the transmembrane domains, the catalytic domains, as well as known targeting domains. The only intact domains remaining are four of the N-terminal binding domains. The Tigrou mutation should produce a completely non-functional protein that is unable to localize appropriately and should be readily degraded. However, it is unknown whether any levels of the truncated protein exist or where the mutant protein localizes. It has been shown in mice that complete ATP7A deficiency invariably results in prenatal lethality (2-4). Since Tigrou males can survive up to 20 days after birth, this suggests some level of ATP7A function remains in these animals although genetic background cannot be discounted from contributing to the different phenotypes seen in Atp7a mutant mice. Several human ATP7A nonsense mutations have been identified that occur approximately in the same region as the Tigrou mouse mutation (5;6). Human males carrying these mutations exhibit severe MD suggesting that truncation of the protein in this region results in non-functional ATP7A. However, at least one patient carrying a nonsense mutation in ATP7A was found expressing two transcripts; a normal size transcript carrying the mutation, and a smaller transcript with the mutated exon spliced out (7). If a similar process occurs in Tigrou animals, the removal of exon 5 leads to an otherwise normally translated protein. Although exon 5 encodes the potentially critical MBD5 (8;9), it is possible that MBD6 and/or the other MBDs may be able to compensate for lack of MBD5 leading to a functional or partially functional protein. The striped pattern in heterozygous females caused by the Tigrou mutation is a result of random X-inactivation early during embryonic development and use of wild-type or mutant ATP7A in various cells and their clonal populations (10). As functional ATP7A is critical for tyrosinase activity, loss of tyrosinase activity in melanocytes will result in pigmentation defects (please see the record for ghost). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Tigrou genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
Tig(F): 5’- TGATGCCAGGGTACAAATTGTCAGC -3’
Tig(R): 5’- GGTTAGGGCAGCCTAAGTACCAAAC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
Tig_seq(F): 5’- GCACAAGAACTGTCTAGTAACTG -3’
Tig_seq(R): 5’- CTAGGCAACTTGGATCTTACAAGG -3’
The following sequence of 1173 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp7a) is amplified:
60664 tgatgcc agggtacaaa ttgtcagcat gataaggcta gttaaataca agcacaagaa
60721 ctgtctagta actggttatt ttctactcgg ggttgggttt ggagataata gctagaagaa 60781 tctgacataa ctaaattttt tgtactcact tgagtcagat tttcttggga cccccctgag 60841 gtggacagta aagaaattca aagtcagtgt tgggaatggg taataacaat atatttgttg 60901 agagctttta ggaccttgct gattttatag aaatgcattg gcaggcctag aggtgtggct 60961 gtgacttttg acaaggtgta agctagagaa taaatgaaaa gaacctttct ctctccagca 61021 gacatgaaag agccactggt agtgatagct cagccctcac tggaaacacc tcttttgccc 61081 tcaagtaatg agctagaaaa tgtgatgacg tcagttcaga acaagtgtta catacaggtc 61141 tctgggatga cctgtgcttc ttgtgtagca aacattgaac gcaatttaag acgagaagaa 61201 ggtaagtgtt gttattttta tgtcccttat ttccagattc tgtccaatct gtgttttatg 61261 gccatgcttt gaagtctttc caaggcttcc ttcccaaaga tcatccttga tgaacaatac 61321 atccctgaat ttctggaagt ttttaattag tgttatttct tttacaatcc cattttagtg 61381 ccagtgaaat ctactaaaaa gtttatagca gaaggaaata catagcatta ctattatgag 61441 ccatggctat aatagccttt aagaaactaa attttttgtt aaagctgttt taaaaagtga 61501 taatgaataa gttaggtatt gtcttatcta gattaaacag cagagccaaa ccatatttgt 61561 gtagaattat attgtctcct ctagcagttt gacctctgat ctttccttgt aagatccaag 61621 ttgcctagta ctgtgtattt taacttcagg ttacaaaatc tttgaaaatc aacaccactg 61681 tttttctgta gttgctcaaa tgttttagtc tataaattta tatacatttt ataggtatat 61741 caataatata gcatagtacc ttagttaacc gtataaatat atgattatgt ttaatgagac 61801 caaagtctta agtttggtac ttaggctgcc ctaacc
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Sophie Rutschmann, Xiao-hong Li, Bruce Beutler. |