Phenotypic Mutation 'Cress' (pdf version)
List |< first << previous [record 89 of 511] next >> last >|
AlleleCress
Mutation Type nonsense
Chromosome4
Coordinate3,789,908 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Lyn
Gene Name Yamaguchi sarcoma viral (v-yes-1) oncogene homolog
Synonym(s) Hck-2
Chromosomal Location 3,678,115-3,813,122 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors.
Accession Number

NCBI RefSeq: NM_001111096, NM_10747; MGI:96892

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: Y501*

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably null
Phenotypic Category decrease in B cells, decrease in B:T cells, decrease in B220 MFI in B cells, decrease in IgD+ B cells, decrease in IgM+ B cells, increase in B1a cells, increase in B1a cells in B1 cells, increase in CD4+ T cells, increase in CD8+ T cells, increase in T cells, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All mutations/alleles(12) : Chemically induced (ENU)(4) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign 0.00
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.92
IGL03328:Lyn APN 4 3745327 missense probably damaging 0.98
IGL03370:Lyn APN 4 3780931 missense probably damaging 1.00
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.29
R0582:Lyn UTSW 4 3743296 missense probably damaging 0.99
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense possibly damaging 0.92
R1703:Lyn UTSW 4 3738867 splice donor site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 0.98
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.00
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign 0.00
R3702:Lyn UTSW 4 3742455 missense probably benign 0.00
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock
MMRRC Submission
Last Updated 09/16/2016 3:55 PM by Katherine Timer
Record Created 12/18/2014 12:06 AM by Jin Huk Choi
Record Posted 01/21/2015
Phenotypic Description

Figure 1. Cress mice exhibit a reduced B to T cell ratio in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Cress mice exhibit a decreased frequency of B cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Cress mice exhibit an increased frequency of B1a cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Cress mice exhibit an increased frequency of B1a cells in B1 cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine the frequency of B1a cells in B1 cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Cress mice exhibit a decreased frequency of IgM+ B cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Cress mice exhibit a decreased percentage of IgD+ B cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Cress mice exhibit an increased frequency of T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Cress mice exhibit an increased frequency of CD4+ T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Cress mice exhibit an increased frequency of CD8+ T cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Cress mice exhibit a reduced B220 mean fluorescence intensity on B cells in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B220 mean fluorescence intensity. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Cress mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide (OVA/Alum). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Cress mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Cress mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Cress phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1460, some of which showed a reduced B to T cell ratio (Figure 1) due to a reduced frequency of total B cells (Figure 2), an increased frequency of B1a cells (Figure 3), an increased frequency of B1a cells in B1 cells (Figure 4), a reduced frequency of IgM+ B cells (Figure 5), and a reduced percentage of IgD+ B cells (Figure 6) with a concomitant increased frequency of T cells (Figure 7) including both CD4+ T cells (Figure 8) and CD8+ T cells (Figure 9), all in the peripheral blood. Some mice also exhibited a reduced B220 mean fluorescence intensity on B cells in the peripheral blood (Figure 10). Some mice showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (OVA/Alum) (Figure 11), a diminished T-dependent response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 12), and a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 13). 

Nature of Mutation

Figure 4. Linkage mapping of the reduced T-dependent response to rSFV-β-gal using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 96 mutations (X-axis) identified in the G1 male of pedigree R1460.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lyn:  a T to A transversion at base pair 3,789,908 (v38) on chromosome 4, or base pair 111,788 in the GenBank genomic region NC_000070.  The strongest association was found with an additive model of linkage to the normalized peripheral IgD+ B cell percentage, wherein three variant homozygotes and eight heterozygotes departed phenotypically from five homozygous reference mice with a P value of 1.583 x 10-8 (Figure 14). A dominant effect was observed for the T-independent B cell response to NP-Ficoll as well as the frequency of B1a cells in B1 cells; a recessive effect was observed for the T-dependent antibody response to OVA/Alum. The mutation corresponds to residue 1,752 in the mRNA sequence NM_001111096 within exon 13 of 13 total exons and residue 1,689 in the mRNA sequence NM_010747 within exon 13 of 13 total exons.

 

111771 GTCCTGGATGACTTCTATACAGCCACAGAAGGG

496    -V--L--D--D--F--Y--T--A--T--E--G-  Lynp56 (NP_001104566)

475    -V--L--D--D--F--Y--T--A--T--E--G-  Lynp53 (NP_034877)

 

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red. Alternative splicing of exon 2 of Lyn produces two Lyn isoforms, Lynp56 and Lynp53, that differ at the N-terminus (1;2); Lynp56 contains an additional 21 amino acids compared to Lynp53 (1). The mutation results in substitution of tyrosine 501 (Tyr501) for a premature stop codon (Tyr501*) in the Lynp56 protein and a Tyr480* in the Lynp53 protein.

Protein Prediction
Figure 15. Domain structure of Lynp56. Please see the text for details about the domains. The Cress mutation (Tyr501*) is indicated in red. The image is interactive; click to view other Lyn mutations.

Lyn is a member of the Src family of tyrosine kinases (SFKs). The members of the SFKs share highly conserved domains including a Src-homology 3 (SH3) domain (amino acids 66-122 in Lyn), an SH2 domain (amino acids 127-217), a tyrosine kinase domain (amino acids 247-497), and a C-terminal regulatory region [Figure 15; reviewed in (3)]. A ‘unique’ domain of 50-70 amino acids between the N-terminus and the SH3 domain varies among the members of the SFKs (3). The Cress mutation (Tyr501*) occurs in the undefined region following the kinase domain in both Lyn isoforms. No functions have been attributed to this region.

 

Please see the record Lemon for information about Lyn.

Putative Mechanism

Lyn can act as both a positive and negative signaling molecule in several cell types including hematopoietic progenitors, mature myeloid cells (neutrophils, macrophages, monocytes, eosinophils, and dendritic cells), platelets, erythrocytes, and osteoclasts. As a result, Lyn regulates several cellular functions including proliferation, degranulation, cytokine production, adhesion, activation, migration, and survival. Following BCR ligation, Lyn phosphorylates the ITAMs of the Igα/Igβ BCR subunits (4-6). These signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for Finlay and xander) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (7)]. Lyn has a non-redundant role in negative regulation of BCR signaling (4). Lyn phosphorylates the ITIMs of the BCR associated co-receptors CD22 (see the record for well), Fc receptor gamma IIb (FcγRIIb), and paired immunoglobulin-like receptor-B (PIR-B) (8-13).

 

Lyn-/- mice exhibit progressive splenomegaly and enlargement of lymph nodes, reduced numbers of mature follicular B cells, absence of marginal zone B cells, produce large quantities of anti-nuclear antibodies, and develop glomerulonephritis as early as 5 months of age (8;14-16). B cells from Lyn-/- mice are both hyperresponsive to BCR ligation and resistant to the inhibitory signals from FcγRIIb and CD22 (8;10;11;14). Peritoneal IgM+ B220+ B cell numbers were significantly lower in Lyn-/- mice at 2 months of age compared to wild-type mice and the size of the Peyer’s patches were reduced (14;16). As a result, CD5 B220high conventional B cells and B1 cells were also reduced (16).  The Cress mice also exhibited a significant reduction in the frequency of peripheral B cell numbers. In addition, the function of the Cress B cells in mounting an antigen-specific immune response is deficient indicating that LynCress exhibits loss of function.

Primers PCR Primer
Cress(F):5'- TGCCACTGAGCAGGGCTTCTAAAC -3'
Cress(R):5'- GCAACAGTCTCTGAACCTGAGTCAC -3'

Sequencing Primer
Cress_seq(F):5'- TGAGCAGGGCTTCTAAACTCTAC -3'
Cress_seq(R):5'- ACTGTGGTCCCATTGAGC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Apiruck Watthanasurorot, Bruce Beutler
List |< first << previous [record 89 of 511] next >> last >|