Phenotypic Mutation 'Kraken'

• Allele: Kraken
• Mutation Type: splice site (3 bp from exon)
• Chromosome: 1
• Coordinate: 45,367,026 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Col3a1
• Gene Name: collagen, type III, alpha 1
• Synonym(s): Tsk-2, Tsk2, Col3a-1
• Chromosomal Location: 45,350,698-45,388,866 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015] ; PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000085192 ^†] † probably from a misspliced transcript
• AlphaFold: P08121
• SMART Domains: Protein: ENSMUSP00000085192; Gene: ENSMUSG00000026043

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWC	33	89	2.73e-20	SMART
low complexity region	100	140	N/A	INTRINSIC
low complexity region	163	227	N/A	INTRINSIC
low complexity region	230	248	N/A	INTRINSIC
internal_repeat_2	249	284	3.45e-13	PROSPERO
internal_repeat_1	250	290	1.9e-17	PROSPERO
Pfam:Collagen	293	366	7.3e-9	PFAM
low complexity region	368	419	N/A	INTRINSIC
internal_repeat_4	423	476	2.52e-11	PROSPERO
internal_repeat_1	427	488	1.9e-17	PROSPERO
internal_repeat_3	427	491	7.39e-12	PROSPERO
internal_repeat_2	456	491	3.45e-13	PROSPERO
Pfam:Collagen	533	592	2.6e-11	PFAM
low complexity region	632	680	N/A	INTRINSIC
low complexity region	683	776	N/A	INTRINSIC
low complexity region	784	815	N/A	INTRINSIC
low complexity region	818	855	N/A	INTRINSIC
low complexity region	865	921	N/A	INTRINSIC
low complexity region	925	950	N/A	INTRINSIC
low complexity region	953	974	N/A	INTRINSIC
internal_repeat_4	975	1028	2.52e-11	PROSPERO
internal_repeat_3	976	1029	7.39e-12	PROSPERO
internal_repeat_5	977	991	3.33e-5	PROSPERO
internal_repeat_5	1019	1033	3.33e-5	PROSPERO
low complexity region	1037	1058	N/A	INTRINSIC
Pfam:Collagen	1076	1135	5.6e-13	PFAM
Pfam:Collagen	1136	1209	4.3e-11	PFAM
COLFI	1229	1464	5.73e-166	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably essential (E-score: 0.790)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2019-09-04 9:46 PM by Anne Murray
• Record Created: 2015-02-23 2:32 PM by Jeff SoRelle
• Record Posted: 2019-01-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jeff SoRelle, Emre Turer, William McAlpine, Noelle Hutchins, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009930; MGI:88453

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Chemically induced (other)(1) Spontaneous(1) Targeted(3)

Phenotypic Description

Figure 1. Kraken mice exhibited susceptibility to DSS-induced colitis at day 10 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Kraken mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Kraken mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Kraken mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The kraken phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1585, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS exposure (Figure 1); weight loss is used to measure DSS susceptibility. Some mice also showed increased frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), and CD8+ T cells (Figure 4) in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the DSS susceptibility phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R1585. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Col3a1: an A to T transversion at base pair 45,327,866 (v38) on chromosome 1, or base pair 16,329 in the GenBank genomic region NC_000067 encoding Col3a1 within the donor splice site of intron 10. The strongest association was found with a recessive model of linkage to the DSS susceptibility phenotype, wherein two variant homozygotes departed phenotypically from 19 homozygous reference mice and 17 heterozygous mice with a P value of 1.636 x 10^-5 (Figure 5).  

The effects of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in exon 10. The resulting transcript would have a 17-base pair deletion of exon 10, which would cause a frame shifted protein product beginning after amino acid 260 of the protein and terminating after the inclusion of 1 aberrant amino acids.

<--exon 9                 <--exon 10 intron 10-->       exon 11--> 22117 ……CCTGGACCTCCA GGTATCAAAGGC……AAAGGACACAGA gtaagtgaccctaatc…… GGCTTTGA…… 244   ……-P--G--P--P- -G--I--K--G-……-K--G--H--R-                    G--L--*- correct deleted aberrant

Genomic numbering corresponds to NC_000067. The donor splice site of intron 10, which is destroyed by the kraken mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 6. Domain organization of COL3A1. The kraken mutation destroys the donor splice site of intron 10. The propeptides are indicated. Abbreviations: SP, signal peptide; VWFC, von Willebrand factor type C; NC1, noncollagenous.

Col3a1 encodes the 1,464-amino acid type III procollagen, α1 chain [α1(III)]. In vertebrates, the collagen superfamily contains 28 different types of collagen (1;2). All collagens have 3 α chains; each α chain is identified by an Arabic numeral followed by a roman numeral in parentheses representing the collagen type (2).  In addition to forming a heterotrimer of three α1(III) chains, COL3A1 assembles with type I collagen (see the record seal for information about Col1a1) to form heterotypic fibrils (3).

Based on sequence homology, the α-chains can be divided into two groups; the α1, α3, and α5 chains, and the α2, α4, α6 chains. Each α chain contains three structurally distinct domains; an N-terminal domain of about 140 amino acids rich in cysteine and lysine residues (known as the 7S domain), a collagenous domain of about 1300 residues largely composed of Gly-Xaa-Yaa repeats, and a C-terminal noncollagenous (NC1) domain that is roughly 230 amino acids long (Figure 6). In the Gly-Xaa-Yaa repeats found in the large collagenous domain, X and Y are often proline and hydroxyproline residues. These sequences have a high propensity to form supercoiled triple helical structures (4). COL3A1 also has a von Willebrand factor type C (vWFC) domain at its N-terminus, which may promote protein-protein interactions and/or oligomerization (SMART).

During incorporation into the extracellular matrix, N- and C-terminal propeptides of COL3A1 are cleaved by bone morphogenic protein-1 and tolloid-like proteinases (5). The N-propeptide includes the VWFC domain, while the C-propeptide contains the NC1 domain. The N-terminal propeptide is a marker of liver fibrosis in patients with chronic liver diseases (6). The N-terminal propeptide is also correlated with the extent of interstitial fibrosis in the kidney (7).

The kraken mutation destroys the donor splice site of intron 10, deletes 17 nucleotides from the Col4a4 cDNA (exon 10), and results in premature protein truncation (Figure 6). 

Expression/Localization

COL3A1 is expressed in tissues that exhibit elastic properties, including skin, lung, liver, intestine and the arterial wall (8). Type III collagen is secreted into the extracellular matrix by fibroblasts and other mesenchymal cell types.

Background

Figure 7. Components of extracellular matrix. The basemement membrane is synthesized by the epithelium and mesenchymal cells. It is found at the base of the epithelium and surrounds vasculature. The basemement membrane comprises laminin, proteoglycans, and Type IV collagen. The interstitial matrix is found surrounding cells in the connective tissue and is synthesized by fibroblasts. Proteogylcans, types I and III collagen, elastin, hyaluronan, and fibrillin are found in the interstitial matrix.

Collagens form the structural basis of skin, tendon, bone, cartilage, and other tissues (Figure 7). Some collagens have a restricted tissue expression pattern; for example types II, IX and XI are found almost exclusively in cartilage and type IV is only in basement membranes (2). Most collagens form some type of supramolecular structure, such as fibrils in the case of type I collagen. Collagens are the most abundant proteins in the human body, making up approximately 30% of its protein mass (2). There are at least 27 collagen types and 42 α chains in vertebrates, in addition to a variety of proteins containing the collagen triple helix motif (2;9). Fibril-forming collagen orthologues have been identified in invertebrates (10), as well as in bacteria and viruses (11).

The role of type III collagen in the organization and biological properties of the extracellular matrix is unknown. Collagen III functions in normal type I collagen fibrillogenesis in the cardiovascular system, intestines, and skin  (12). Together with collagen I, collagen III is a major component of the interstitial matrix.

Type III collagen is a ligand for several proteins, including G protein-coupled receptor-56 (GPR56), discoidin domain receptors (DDRs) 1 and 2, von Willebrand factor, and integrin α2β1 (13;14). The interaction between GPR57 and COL3A1 regulates cortical development by regulating pial basement membrane integrity and cortical lamination, subsequently inhibiting neural migration (15). The interaction between COL3A1 and DDR1/2 controls cell proliferation, adhesion, migration, and extracellular matrix remodeling. Aberrant interaction between COL3A1 and DDR1/2 is linked to fibrosis, atherosclerosis, cancer, and arthritis (16). Binding of COL3A1 to vWF and integrin α2β1 promote wound healing.

Mutations in COL3A1 have been linked to Ehrlos-Danlos syndrome type IV in humans (OMIM: #130050; (17;18)). Ehrlos-Danlos syndromes are connective tissue disorders; Ehrlos-Danlos syndrome type IV is the vascular type of Ehrlos-Danlos syndrome. Patients with Ehrlos-Danlos syndrome type IV exhibit acrogeria (i.e., emaciated face with prominent cheekbones and sunken cheeks and premature aging of the extremities), translucent skin with visible subcutaneous vessels on the trunk and lower back, easy bruising, spontaneous rupture of blood vessels, digestive ruptures, and perforations of the gravid uterus (17;19). The median age of death for Ehrlos-Danlos syndrome type IV patients is 50 years of age; arterial ruptures cause the majority of deaths (19).

Levels of matrix metalloproteinase-9-degraded type III collagen are elevated in penetrating (Montreal B3) Crohn’s disease (20). Also, plasma concentrations of COL3A1 is higher in patients with Crohn’s disease who later developed strictures compared to Crohn’s disease patients without strictures (21). COL3A1 is a disease-associated gene in gastroesophageal reflux disease as well as a male risk factor for hiatal hernia (22).

Homozygous mice expressing a spontaneous intergenic deletion of the first 38 exons of Col3a1 exhibited embryonic lethality before embryonic day 9.5 (23). Heterozygous mice exhibited premature death on average at 6 weeks of age due to spontaneous aortic dissection between 4 and 10 weeks of age (23). Most Col3a1-deficient (Col3a1^-/-) mice exhibited postnatal lethality within the first 48 hours after birth primarily due to ruptured blood vessels and/or intestinal rupture; surviving Col3a1^-/- mice exhibited an average survival rate of 5% at weaning age and were reduced in size compared to wild-type littermates (12). Heterozygous (Col3a1^+/-) mice showed reduced wall strength in the aorta and colon  (24). Homozygous mice expressing an ENU-induced Col3a1 allele (Col3a1^Tsk2/Tsk2) causing a cysteine to serine substitution at amino acid 33 (C33S) exhibited prenatal lethality. Heterozygous Col3a1^Tsk2 mice exhibited adipose tissue and skin inflammation as well as thick and tight skin (25). Transgenic mice expressing a Gly182Ser mutation in COL3A1 showed vascular and dermal fragility as well as malformed dermal and aortic collagen fibrils (26).

Putative Mechanism

Fibrosis is a complication of chronic inflammation that occurs in inflammatory bowel disease, and COL3A1 is one of several profibrogenic extracellular matrix genes upregulated during the active/chronic inflammatory stage in a trinitrobenzene sulfonic acid (TNBS)-induced murine colitis model (27). The DSS-induced colitis phenotype observed in the kraken mice indicates loss of COL3A1-associated function in the intestine. However, some COL3A1 function may remain as the kraken mice did not exhibit premature death. The mutation in kraken may be leading to increased incidence of blood vessel rupture and/or aberrant fibrosis in the intestine.

Primers

PCR Primer
Kraken_pcr_F: TGCCTGGACCTCCAGTAAGTCTTC
Kraken_pcr_R: TGAACTGCTGAACATTTGGCAACG

Sequencing Primer
Kraken_seq_F: TCACTGAATGTTGACTTGAATGTTA
Kraken_seq_R: CTGAACATTTGGCAACGTATTATTAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 486 nucleotides is amplified (chromosome 1, + strand):

1   tgcctggacc tccagtaagt cttcattaaa taaactacct agaacataca aagtatttta
61  attttaactt caaaaaaaaa cccaaataat caaattaaaa taaacatcaa aataaatgca
121 tttttatcac tgaatgttga cttgaatgtt aattaacatc tttcccattc attactttta
181 gggtatcaaa ggcccagctg gcatgcctgg attccctggt atgaaaggac acagagtaag
241 tgaccctaat cctaaccctg tattcatgaa cttagatata atttataaat ggacagagca
301 cttttagttt taacaaactt tagataaagt caatccatcc aaaatctatc aaactaagaa
361 caatatccat caaactagag tttattcttc tatacttaag acaacttttt aatcatacta
421 aattgaatgt tctcattagt ttctcttttt tttgtaataa tacgttgcca aatgttcagc
481 agttca

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Khoshnoodi, J., Pedchenko, V., and Hudson, B. G. (2008) Mammalian Collagen IV. Microsc Res Tech. 71, 357-370.

  2. Myllyharju, J., and Kivirikko, K. I. (2004) Collagens, Modifying Enzymes and their Mutations in Humans, Flies and Worms. Trends Genet. 20, 33-43.

  3. Keene, D. R., Sakai, L. Y., Bachinger, H. P., and Burgeson, R. E. (1987) Type III Collagen can be Present on Banded Collagen Fibrils Regardless of Fibril Diameter. J Cell Biol. 105, 2393-2402.

  4. Jenkins, C. L., and Raines, R. T. (2002) Insights on the Conformational Stability of Collagen. Nat Prod Rep. 19, 49-59.

  5. Canty, E. G., and Kadler, K. E. (2005) Procollagen Trafficking, Processing and Fibrillogenesis. J Cell Sci. 118, 1341-1353.

  6. Guechot, J., Laudat, A., Loria, A., Serfaty, L., Poupon, R., and Giboudeau, J. (1996) Diagnostic Accuracy of Hyaluronan and Type III Procollagen Amino-Terminal Peptide Serum Assays as Markers of Liver Fibrosis in Chronic Viral Hepatitis C Evaluated by ROC Curve Analysis. Clin Chem. 42, 558-563.

  7. Ghoul, B. E., Squalli, T., Servais, A., Elie, C., Meas-Yedid, V., Trivint, C., Vanmassenhove, J., Grunfeld, J. P., Olivo-Marin, J. C., Thervet, E., Noel, L. H., Prie, D., and Fakhouri, F. (2010) Urinary Procollagen III Aminoterminal Propeptide (PIIINP): A Fibrotest for the Nephrologist. Clin J Am Soc Nephrol. 5, 205-210.

  8. Gelse, K., Poschl, E., and Aigner, T. (2003) Collagens--Structure, Function, and Biosynthesis. Adv Drug Deliv Rev. 55, 1531-1546.

  9. Brodsky, B., and Persikov, A. V. (2005) Molecular Structure of the Collagen Triple Helix. Adv Protein Chem. 70, 301-339.

  10. Exposito, J. Y., Cluzel, C., Garrone, R., and Lethias, C. (2002) Evolution of Collagens. Anat Rec. 268, 302-316.

  11. Rasmussen, M., Jacobsson, M., and Bjorck, L. (2003) Genome-Based Identification and Analysis of Collagen-Related Structural Motifs in Bacterial and Viral Proteins. J Biol Chem. 278, 32313-32316.

  12. Liu, X., Wu, H., Byrne, M., Krane, S., and Jaenisch, R. (1997) Type III Collagen is Crucial for Collagen I Fibrillogenesis and for Normal Cardiovascular Development. Proc Natl Acad Sci U S A. 94, 1852-1856.

  13. Lisman, T., Raynal, N., Groeneveld, D., Maddox, B., Peachey, A. R., Huizinga, E. G., de Groot, P. G., and Farndale, R. W. (2006) A Single High-Affinity Binding Site for Von Willebrand Factor in Collagen III, Identified using Synthetic Triple-Helical Peptides. Blood. 108, 3753-3756.

  14. Xu, H., Raynal, N., Stathopoulos, S., Myllyharju, J., Farndale, R. W., and Leitinger, B. (2011) Collagen Binding Specificity of the Discoidin Domain Receptors: Binding Sites on Collagens II and III and Molecular Determinants for Collagen IV Recognition by DDR1. Matrix Biol. 30, 16-26.

  15. Luo, R., Jeong, S. J., Jin, Z., Strokes, N., Li, S., and Piao, X. (2011) G Protein-Coupled Receptor 56 and Collagen III, a Receptor-Ligand Pair, Regulates Cortical Development and Lamination. Proc Natl Acad Sci U S A. 108, 12925-12930.

  16. Vogel, W. F., Abdulhussein, R., and Ford, C. E. (2006) Sensing Extracellular Matrix: An Update on Discoidin Domain Receptor Function. Cell Signal. 18, 1108-1116.

  17. Blaker, H., Funke, B., Hausser, I., Hackert, T., Schirmacher, P., and Autschbach, F. (2007) Pathology of the Large Intestine in Patients with Vascular Type Ehlers-Danlos Syndrome. Virchows Arch. 450, 713-717.

  18. Kuivaniemi, H., Tromp, G., and Prockop, D. J. (1997) Mutations in Fibrillar Collagens (Types I, II, III, and XI), Fibril-Associated Collagen (Type IX), and Network-Forming Collagen (Type X) Cause a Spectrum of Diseases of Bone, Cartilage, and Blood Vessels. Hum Mutat. 9, 300-315.

  19. Pepin, M., Schwarze, U., Superti-Furga, A., and Byers, P. H. (2000) Clinical and Genetic Features of Ehlers-Danlos Syndrome Type IV, the Vascular Type. N Engl J Med. 342, 673-680.

  20. van Haaften, W. T., Mortensen, J. H., Karsdal, M. A., Bay-Jensen, A. C., Dijkstra, G., and Olinga, P. (2017) Misbalance in Type III Collagen formation/degradation as a Novel Serological Biomarker for Penetrating (Montreal B3) Crohn's Disease. Aliment Pharmacol Ther. 46, 26-39.

  21. Ballengee, C. R., Stidham, R. W., Liu, C., Kim, M. O., Prince, J., Mondal, K., Baldassano, R., Dubinsky, M., Markowitz, J., Leleiko, N., Hyams, J., Denson, L., and Kugathasan, S. (2018) Association between Plasma Level of Collagen Type III Alpha 1 Chain and Development of Strictures in Pediatric Patients with Crohn's Disease. Clin Gastroenterol Hepatol. .

  22. Asling, B., Jirholt, J., Hammond, P., Knutsson, M., Walentinsson, A., Davidson, G., Agreus, L., Lehmann, A., and Lagerstrom-Fermer, M. (2009) Collagen Type III Alpha I is a Gastro-Oesophageal Reflux Disease Susceptibility Gene and a Male Risk Factor for Hiatus Hernia. Gut. 58, 1063-1069.

  23. Smith, L. B., Hadoke, P. W., Dyer, E., Denvir, M. A., Brownstein, D., Miller, E., Nelson, N., Wells, S., Cheeseman, M., and Greenfield, A. (2011) Haploinsufficiency of the Murine Col3a1 Locus Causes Aortic Dissection: A Novel Model of the Vascular Type of Ehlers-Danlos Syndrome. Cardiovasc Res. 90, 182-190.

  24. Cooper, T. K., Zhong, Q., Krawczyk, M., Tae, H. J., Muller, G. A., Schubert, R., Myers, L. A., Dietz, H. C., Talan, M. I., and Briest, W. (2010) The Haploinsufficient Col3a1 Mouse as a Model for Vascular Ehlers-Danlos Syndrome. Vet Pathol. 47, 1028-1039.

  25. Christner, P. J., Peters, J., Hawkins, D., Siracusa, L. D., and Jimenez, S. A. (1995) The Tight Skin 2 Mouse. an Animal Model of Scleroderma Displaying Cutaneous Fibrosis and Mononuclear Cell Infiltration. Arthritis Rheum. 38, 1791-1798.

  26. D'hondt, S., Guillemyn, B., Syx, D., Symoens, S., De Rycke, R., Vanhoutte, L., Toussaint, W., Lambrecht, B. N., De Paepe, A., Keene, D. R., Ishikawa, Y., Bachinger, H. P., Janssens, S., Bertrand, M. J. M., and Malfait, F. (2018) Type III Collagen Affects Dermal and Vascular Collagen Fibrillogenesis and Tissue Integrity in a Mutant Col3a1 Transgenic Mouse Model. Matrix Biol. 70, 72-83.

  27. Wu, F., and Chakravarti, S. (2007) Differential Expression of Inflammatory and Fibrogenic Genes and their Regulation by NF-kappaB Inhibition in a Mouse Model of Chronic Colitis. J Immunol. 179, 6988-7000.