Allele | pinkie | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 27,642,346 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Rxra | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | retinoid X receptor alpha | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | RXRalpha1, 9530071D11Rik, RXR alpha 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 27,566,452-27,652,969 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014] PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_011305; MGI: 98214 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Isoleucine changed to Asparagine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P28700 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000076491 Gene: ENSMUSG00000015846 AA Change: I273N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000097822 Gene: ENSMUSG00000015846 AA Change: I245N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000109567 Gene: ENSMUSG00000015846 AA Change: I245N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000133044 Gene: ENSMUSG00000015846 AA Change: I273N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Essential (E-score: 1.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(15) : Targeted, knock-out(7) Targeted, other(2) Gene trapped(5) Chemically induced(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos, Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 012828-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2017-04-11 4:44 PM by Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2007-09-19 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The pinkie phenotype was identified as a visible phenotype among G3 mice homozygous for mutations induced by ENU (1). The fur of pinkie mice grays prematurely, beginning on the snout as early as 5 weeks of age and spreading to the trunk (Figure 1A, B). Alopecia progresses from the caudal ventral surface to the lower back, and then to the rest of the body. By 4 months of age, pinkie mice are typically hairless, with a thin and hypopigmented appearance of the skin, often exhibiting dermatitis (Figure 1C).
Homozygous pinkie females develop cysts under the ventral skin at approximately 8 weeks of age, which progressively increase in size and number. The cysts have black spots on the top surface. Compared to females, males are affected with cysts less severely and onset begins later in life.
Some mutants develop a hunchback (dorsal kyphosis) by 1 year of age.
With age, pinkie mice develop “dry” eyes and corneal opacity.
Pinkie mice are fertile for only approximately 6 months.
Pinkie mice display the following immune system phenotypes: Although lymphocyte count and CD4+:CD8+ T cell ratios are normal in pinkie mice, they display a progressive impairment in T helper type 2 (Th2) antigen-specific IgG1 production following immunization with ovalbumin and alum. In vitro, naïve pinkie CD4+ T cells favor differentiation to Th1 when exposed to conditions supporting mixed Th1/Th2 differentiation. pinkie dendritic cells (DCs) produce increased levels of interleukin-12 (IL-12), regardless of TLR4 stimulation.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | The pinkie mutation was mapped to Chromosome 2, and corresponds to a T to A transversion at position 1050 of the Rxrα transcript, in exon 6 of 10 total exons.
1034 GACCCTGTTACCAACATCTGTCAAGCAGCAGAC
268 -D--P--V--T--N--I--C--Q--A--A--D-
The mutated nucleotide is indicated in red lettering, and results in a conversion of isoleucine to asparagine at residue 273 of the RXRα protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | RXRs belong to the nuclear receptor superfamily, and act as ligand-inducible transcription factors regulating expression of target genes involved in vertebrate morphogenesis, growth, differentiation, and tissue homeostasis [reviewed in (2)]. The RXR subfamily binds to 9-cis RA and includes RXRα, -β and -γ isoforms (4). RXRs form heterodimers with both RARs and with other nuclear receptors such as thyroid hormone (TR) and vitamin D3 (VDR) receptors (5).
A great many studies have undertaken to understand the physiological roles of RXRs through the generation of mice lacking RXR function [discussed in (2)]. RXRα-null mutants die as embryos between days 13.5 and 16.5 (6), likely due to cardiac failure caused by a hypoplasia of the ventricular myocardium (7). A similar myocardial defect is observed as a result of vitamin A deficiency (7). RXRα-null and vitamin A-deficient mice also display similar embryonic ocular malformations, including persistent and hyperplastic vitreous body (PHPV), closer eyelid folds, and a shortening of the ventral retina (6). In addition to these phenotypes, RXRα has been implicated in the embryonic morphogenesis of skeleton and cartilage (8). In a skin-specific RXRα mutant, progressive alopecia and cyst formation occurs (9;10) as in pinkie mice. Skin-specific RXRα mutant epidermis is also hyperplastic and hyperkeratinized (9;10). Several other tissue-specific RXRα mutants have been generated; more information on their phenotypes may be found at MGI.
An adequate supply of vitamin A is important for immune function, especially during infancy and early childhood (11). Vitamin A deficiency leads to impaired T-lymphocyte-mediated antibody responses (12), and also generates a bias towards T helper type 1 (Th1) cells (13). This bias may be attributed to increased interleukin-12 (IL-12) production by antigen-presenting cells (APCs) (14) and increased interferon-γ (IFN-γ) production by T lymphocytes (15). Conversely, RA treatment (using 9-cis RA) of T cells in vitro suppresses Th1, but enhances Th2 development (16). Recently, RXRα has been disrupted specifically in thymocytes and T lymphocytes using Cre-lox technology (17). In contrast to data from pinkie mice, naïve CD4+ T cells in vitro displayed no Th1 differentiation bias in thymocyte- and T lymphocyte-deficient RXRα (RXRαko/ko) mice as measured by intracellular staining for IL-4 and IFN-γ, and by antigen-specific IgG1 production in response to immunization with ovalbumin. However, RXRαko/ko memory CD4+ T cells produced more IFN-γ and IL-12 compared to wild type cells (17).
In addition to RARs, RXRα can heterodimerize with the VDR and contribute to signaling from this complex. 1,25-Dihydroxyvitamin D3 (vitD3) affects Th cell polarization by inhibiting secretion of IL-12 and IFN-γ, thus inhibiting Th1 development (18;19). VitD3 also enhances IL-4 and IL-10 production, leading to skewing towards Th2 development (19). A recent study reports that VDR-null mice exhibit progressive alopecia caused by the disruption of hair follicle structure (20).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | RXRα null mutants die as embryos, highlighting the importance of signaling from complexes that include this molecule. Although mutant RXRα in pinkie mice retains only 10% of its signaling activity, pinkie mice survive to adulthood, possibly due to the 2-fold upregulation of mRNA expression of mutant RXRα, and potential redundancy with RXRβ and RXRγ. Expression of the Rxrα locus is downregulated with age in hepatic cells (21), and may explain the progressive phenotype of pinkie mice. As these mice age, the combined reduction in RXRα activity due to downregulation of the locus and the loss of signaling function due to the mutation, may lead to a gradually worsening phenotype.
pinkie mice display Th1-skewed Th cell function, consistent with data from thymocyte- and T lymphocyte-deficient RXRα mice and from studies of vitD3- or RA-treated T cells in culture. In these studies, increased vitD3- or RA-stimulated signaling favored Th2 development. In contrast, the RXRα mutation in pinkie mice would impair signaling from both the VDR and RAR complexes, leading to increased IL-12 production and promoting Th1 development.
Several transcription factors are important for differentiation into Th1 versus Th2 cell subsets. The transcription factors GATA-3 and c-Maf promote Th2 differentiation. Transgenic expression of GATA-3 (22) or overexpression of c-maf (23) in mice inhibited Th1 development while enhancing Th2 development. Lack of GATA-3, on the other hand, prevents the development of Th2 cells (24). Consistent with these data, cultured T cells from pinkie mice expressed slightly lower levels of GATA-3 mRNA.
The transcription factor T-bet has been implicated in directing the Th1 lineage. Expression of T-bet in Th2 cells redirects them to Th1 class (25), and T-bet-deficient mice have Th2-skewed CD4+ cell populations (26). Promotion of Th-1 development through T-bet depends on downregulation of GATA-3 (26). pinkie T cells express elevated levels of T-bet mRNA, which would contribute to lowering GATA-3 levels. However, culture conditions favoring exclusive Th2 differentiation still lead to Th2 in pinkie mice, indicating that pinkie T cells are Th2 competent. Apparently, the remaining GATA-3 in pinkie T cells is insufficient to promote significant Th2 differentiation. C-Maf levels in pinkie mice have not been measured.
Although pinkie eye development appears normal, the appearance of corneal opacity and dry eyes may be related to impaired RA signaling that causes embryonic ocular malformations.
Dorsal kyphosis in pinkie mice may be due to impaired RA and vitD3 signaling, as both vitamin A and vitamin D are important for bone development. Vitamin D deficiency causes rickets in humans (27), and RA can stimulate osteoclast formation (28). RXRα may signal with both RAR and VDR to maintain bone structure and prevent kyphosis in pinkie mice.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Pinkie genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
Primers
Pink(F): 5’- GCTTCTTCTGATGACCACTGCCTTG -3’
Pink(R): 5’-ACACGGCTGCAGAGGTCACATAGAC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:15
3) 60°C 0:30
4) 68°C 1:00
5) repeat steps (2-4) 35X
6) 68°C 5:00
7) 4°C ∞
The following sequence of 512 nucleotides (from Genbank genomic region NC_000068 for linear DNA sequence of Rxra) is amplified:
74882 gcttcttct gatgaccact gccttggtac tagtcccgct ccaataagcc agggcttcct
74941 ccagcctgtt actatggtgg atctcttctc agagtccttt cactgtgcca ggcctccgat
75001 ggtttgggat gcagatcctg ggaccccact ccatgggtgt tttgtgtggg gtgaggtggc
75061 tctgtcggct atcaggtgtg aggtttgatc aatgtccttt ctccgttcta gccaaatgac
75121 cctgttacca acatctgtca agcagcagac aagcagctct tcactcttgt ggagtgggcc
75181 aagaggatcc cacacttttc tgagctgccc ctagacgacc aggtcatcct gctacgggca
75241 ggtgagtagc ctgggcaagt ggctgctagt ggatcagtgg gctcctgccc actcctgcat
75301 gcggtatagc gctaccttcc ccttccagct tagaaagtca gtaaagggtc tcctcggctg
75361 cccgccaggt ctatgtgacc tctgcagccg tgt
Primer binding sites are underlined; the mutated T is highlighted in red.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | 1. Du, X., Tabeta, K., Mann, N., Crozat, K., Mudd, S., and Beutler, B. (2005) An essential role for Rxralpha in the development of Th2 responses, Eur. J. Immunol. 35, 3414-3423. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xin Du, Bruce Beutler |