Phenotypic Mutation 'Polished2'

• Allele: Polished2
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 99,906,676 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Krt33a
• Gene Name: keratin 33A
• Synonym(s): 2310015J09Rik
• Chromosomal Location: 99,902,025-99,907,038 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Serine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8K0Y2
• SMART Domains: Protein: ENSMUSP00000018399; Gene: ENSMUSG00000035592; AA Change: C100S

Domain	Start	End	E-Value	Type
low complexity region	11	26	N/A	INTRINSIC
Filament	55	366	1.99e-148	SMART
internal_repeat_1	368	385	6.11e-5	PROSPERO
internal_repeat_1	384	399	6.11e-5	PROSPERO

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
  (Using ENSMUST00000018399)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.076)
• Phenotypic Category: Autosomal Dominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Sperm, gDNA
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: unknown
• Record Posted: 2008-07-25
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Amanda L. Blasius, Bruce Beutler

Accession Number

NCBI RefSeq: NM_027983, MGI: 1919138

Alleles Listed at MGI

All alleles(5) : Targeted, other(2) Chemically induced(3)

Repository

none

Phenotypic Description

The dominant Polished2 mutation was identified in N-ethyl-N-nitrosourea (ENU)-induced G1 mutant mice.  Heterozygous animals have a shiny, reflective, “polished” looking coat.  Polished2 mice appear identical to allelic Polished mice.

Nature of Mutation

The Polished2 mutation was mapped to Chromosome 11, and corresponds to a T to C transition at position 363 of the Krt33a transcript, in exon 1 of 7 total exons. 

 

348  CAGGACCCCCTGGTGTGTCCTGCCTACCAGGCC

95  -Q--D--P--L--V--C--P--A--Y--Q--A-

 

The mutated nucleotide is indicated in red lettering, and causes a cysteine to arginine change at residue 100 of the Keratin 33a (K33a) protein.

Protein Prediction

Figure 1. Keratin domain structure showing the α-helical domain, linker regions and head/tail domains. The Polished2 mutation results in the substitution of an arginine for a cysteine at amino acid 100 of the Keratin 33a protein. This image is interactive. Click on the image to view other mutations found in Krt33a (red). Click on the mutations for more specific information.   

The Polished2 mutation results in the substitution of an arginine for a cysteine at amino acid 100 of Keratin 33a.  This residue is located in the first linker domain (L1) of the protein (Figure 1).

 

Please see the record for Polished for information about Krt33a.

Putative Mechanism

The Polished2 mutation alters a highly conserved amino acid in the first linker domain of the K33a protein.  Unlike the α-helical domain, the linker domains of keratin proteins are not typically important for heterodimerization of keratin molecules.  However, keratins are known to contain a high number of cysteines that typically form disulfide bonds to confer additional strength and rigidity to the IFs formed from keratin proteins (1).  It is possible the cysteine altered in the mutant Polished2 K33a protein is involved in such an interaction.  Disease-causing mutations in the L1 domain of keratins are very rare (please see the intermediate filament database at www.interfil.org).  

Primers

Primers cannot be located by automatic search.

Genotyping

Polished2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Pol2(F): 5’- GAAGCAGAGCAAATGAATGGGGTAGC -3’

Pol2(R): 5’- TATCTAAACTCCTATGACCTCCACCAAGTC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Pol2_seq(F): 5’- GGAGAATACACACCTCATCTTCAGC -3’

Pol2_seq(R): 5’- ACCACGCCAAGAGTTCATGTC -3’

 

The following sequence of 1044 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Krt33a plus 138 additional nucleotides taken from NCBI m37 mouse assembly Chromosome 11: 99872516:99877664) is amplified:

 

-138                                               gaagcaga gcaaatgaat

-121 ggggtagcct ttgaccatca ctaaatgagc aaagccaaaa gaaaaaagag agagagactg

 -61 acttatacgt ccccacccaa tttggagtgg atataaaagc tcaccagagg aaggggactc

   1 agagctctga ggcttggaga atacacacct catcttcagc caggcacctc cctccctcca

  61 gcaccatgcc atacaactgc tgcctgcccg ccatgagctg ccgcaccagc tgctcttcca

 121 ggccctgcgt gccccccagc tgccatggct gcaccctgcc cggggcctgc aacatccccg

 181 ccaatgtggg caactgcaat tggttctgtg agggctcctt caatggcaat gagaaggaga

 241 ccatgcagtt cctgaatgac cgcctggcct cctatatgga gaaggtgagg cagctggaga

 301 gagagaatgc agagctggaa tgtaggatcc aggagaggaa ccagcagcag gaccccctgg

 361 tgtgtcctgc ctaccaggcc tacttcagga ccattgagga gctgcagcag aaggtgagcg

 421 ggacgggcac ccacagcatt cctagcagga agttctcagg agaacgtgtg agacacagaa

 481 atgacatgaa ctcttggcgt ggtggaaaat ttgataacca catttccagc tttttaagca

 541 ttttttttct tgtggactct tctatttgca gactggagac tgttagtttt gaatcttggc

 601 agaaattaga cttggtggag gtcataggag tttagata

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.

References

  1.  Hatzfeld, M. and Franke, W. W. (1985) Pair formation and promiscuity of cytokeratins: formation in vitro of heterotypic complexes and intermediate-sized filaments by homologous and heterologous recombinations of purified polypeptides, J. Cell Biol. 101, 1826-1841.