Phenotypic Mutation 'Peter'

• Allele: Peter
• Mutation Type: missense
• Chromosome: 5
• Coordinate: 24,582,853 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Nos3
• Gene Name: nitric oxide synthase 3, endothelial cell
• Synonym(s): 2310065A03Rik, ecNOS, eNOS, Nos-3
• Chromosomal Location: 24,569,808-24,589,472 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Tyrosine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000030834] [ENSMUSP00000110742]
• AlphaFold: P70313
• SMART Domains: Protein: ENSMUSP00000030834; Gene: ENSMUSG00000028978; AA Change: C660Y

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	118	480	1.7e-183	PFAM
Pfam:Flavodoxin_1	521	697	4.8e-54	PFAM
Pfam:FAD_binding_1	750	978	2.1e-82	PFAM
Pfam:NAD_binding_1	1010	1124	1.9e-18	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
  (Using ENSMUST00000030834)
• SMART Domains: Protein: ENSMUSP00000110742; Gene: ENSMUSG00000028978; AA Change: C660Y

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	114	485	9e-214	PFAM
Pfam:Flavodoxin_1	521	697	3.8e-54	PFAM
Pfam:FAD_binding_1	750	978	1.6e-79	PFAM
Pfam:NAD_binding_1	1010	1091	5.6e-12	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
  (Using ENSMUST00000115090)
• Meta Mutation Damage Score: 0.8127
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-22 1:59 PM by Bruce Beutler
• Record Posted: 2019-01-30
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008713; MGI:97362

Alleles Listed at MGI

All Mutations and Alleles(18) : Chemically induced (ENU)(1) Chemically induced (other)(2) Gene trapped(1) Radiation induced(1) Spontaneous(1) Targeted(9) Transgenic(3)

Phenotypic Description

Figure 1. Peter mice exhibit weight loss seven days after exposure to dextran sulfate sodium. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Peter phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4947 in a screen for mutants susceptible to dextran sulfate sodium (DSS)-induced colitis. The screen uses weight-loss as an indication of colitis. The peter mice were susceptible to low doses of DSS (1%) and showed weight loss seven days after DSS treatment (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the DSS-induced weight loss using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R4947. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Nos3: a G to A transition at base pair 24,377,855 (v38) on chromosome 5, or base pair 13,037 in the GenBank genomic region NC_000071. Linkage was found with an additive model of inheritance (P = 4.587 x 10^-5), wherein three variant homozygotes and 13 heterozygous mice departed phenotypically from five homozygous reference mice (Figure 2).  

The mutation corresponds to residue 1,998 in the mRNA sequence NM_008713 within exon 16 of 26 total exons.

1982 GCATACCCCCACTTCTGTGCCTTTGCTCGAGCG 655  -A--Y--P--H--F--C--A--F--A--R--A-

The mutated nucleotide is indicated in red.  The mutation results in a cysteine to tyrosine substitution at position 660 (C660Y) in the NOS3 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.994).

Protein Prediction

Figure 3. Protein domain organization of NOS3.  NOS3 has an N-terminal oxygenase domain that interacts with Heme (designated as HEME), a calmodulin (CaM)-binding region), a flavodoxin region, a flavin adenine dinucleotide (FAD)-binding region (FBR), and a nicotinamide adenine dinucleotide phosphate (NADPH)-binding region (NBR). The Peter mutation results in a cysteine to tyrosine substitution at position 660. This image is interactive. Other mutations found in NOS3 are noted in red. Click on each mutation for more information.

Nitric oxide synthase 3 [NOS3; alternatively, endothelial NOS (eNOS)] is one of three nitric oxide synthase (NOS) enzymes. All of the NOS proteins share similar protein domains including an N-terminal oxygenase domain and a C-terminal reductase domain connected by a CaM-binding region (amino acids 490-509 in mouse NOS3) (Figure 3). The oxygenase domain of NOS3 (amino acids 39-482) has binding sites for heme, L-arginine, and BH₄. The NOS3 reductase domain (amino acids 519-1001) has binding sites for nicotinamide adenine dinucleotide phosphate (NADPH), FMN (amino acids 519-702), and FAD (amino acids 755-1001). The NOS proteins differ in the region N-terminal to the oxygenase domain; that N-terminal peptide has an undefined function in NOS3.

The Peter mutation results in a cysteine to tyrosine substitution at position 660 (C660Y) within the flavodoxin region of the reductase domain.

Please see the record paul for more information about Nos3.

Putative Mechanism

The NOS proteins catalyze the conversion of L-arginine and oxygen into L-citrulline and nitric oxide (NO) in a NADPH-dependent reaction. The conversion of L-arginine to L-citrulline occurs in a two-step oxidation process. The reaction consumes 1.5 mol of NADPH and 2 mol of oxygen per mol of L-citrulline formed. In the initial reaction, L-arginine is hydroxylated, leading to the formation of N^G-hydroxy-l-arginine, an alternative substrate of NOS. The intermediate is subsequently oxidated using one electron from NADPH, forming L-citrulline and NO. NO is a signaling molecule that functions in several physiological processes including cell growth, apoptosis, neurotransmission, and immune system regulation. During normoxic cellular conditions, NOS-derived NO is oxidized to nitrite and nitrate. NOS can also catalyze the production of superoxide.

NOS3 constitutively produces NO in the vasculature. NOS3-produced NO mediates neovascularization, vessel wall tension, platelet aggregation, vascular permeability and the interaction between leuckocytes and endothelial cells [reviewed in (1)]. In the heart, NOS3-derived NO mediates vasodilation, vascular homeostasis, morphogenesis of coronary arteries, myocardial capillary development, and angiogenesis [(2); reviewed in (3)]. NOS3-derived NO regulates voltage-dependent L-type calcium currents in cardiomyocytes as well as cardiomyogenesis during embryonic development (4-6). NO is proposed to function in cardiac cells to alter basal contractility by activating the nitrosylation of the ryanodine receptor 2 (RyR2) (7), by directing S-nitrosylatin of the L-type calcium channel (8), by mediating cGMP-independent activation of adenylyl cyclase (9), by mediating a cGMP-dependent increase in cAMP (10), and by assisting in a PKG-mediated activation of the RyR (11). Transgenic mice that overexpress NOS3 in the vascular wall exhibited low blood pressure as well as reduced vascular reactivity compared to wild-type littermates (12). In the kidney, NOS3-produced NO inhibited NaCl and NaHCO₃ absorption through the inhibition of transporters including the Na/K/2Cl co-transporter and Na/H exchangers (13-15). In the lung, NOS3-produced NO stimulates ciliary beat frequency to regulate the amount and composition of airway surface liquid (16). In the bone marrow, NOS3-derived NO regulates the mobilization of bone marrow-derived hematopoietic stem and progenitor cells (17;18).

Nos3^-/- mice exhibit developmental vascular defects in certain organs including heart, aorta, lung, and kidney with a concomitant increased rate of postnatal mortality compared to wild-type mice (19-25).

During normal conditions, NOS3-derived NO is a scavenger that absorbs O₂^- and also functions to generate the oxidant peroxynitrite (ONOO^-). In inflammatory bowel disease (IBD), NOS3 expression is reduced, leading to reduced endothelium-dependent vasodilation and increased oxidant formation (26). Loss of Nos3 expression leads to an increased severity of IBD (27;28). Treatment of Nos3^-/- mice with 3% DSS led to an increased rate of weight loss, bloody stool, and histopathology including disrupted tissue architecture, edema, and immune cell infiltration compared to DSS-treated wild-type mice (28). The Nos3^-/- mice exhibited more gut injury and higher expression levels of the mucosal addressin MAdCAM-1 compared to DSS-treated wild-type mice. Similar to the Nos3^-/- mice , homozygous paul mice also exhibit weight loss after treatment with low dose (1.5%) DSS, indicating loss of NOS3 function as the result of the mutation. Exposure of HUVECs to serum from patients with Crohn’s disease led to a reduction in NOS3, while exposure to serum from patients with ulcerative colitis led to an increase in NOS3 expression (29). Chronic administration of NOS inhibitors can cause intestinal inflammation (30;31). Studies using NOS inhibitors N(G)-nitro-L-arginine-methyl ester (L-NAME) and NG-Monomethyl-L-Arginine (L-NMMA) indicated that loss of NO leads to increased mucosal permeability (32). The increased permeability can be reversed by treatment with NO donors, L-arginine, or cGMP donors.

The DSS-induced colitis phenotype observed in the Peter mice indicates loss of NOS3-associated function.

Primers

PCR Primer
Peter_pcr_F: TCAACAGTGTCTCCTGCTCAG
Peter_pcr_R: ACCATGGTGCTGATCCAGTC

Sequencing Primer
Peter_seq_F: CACTGGTATCCTCTTGGCGG
Peter_seq_R: TGATCCAGTCAGATACAGGGTACC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 421 nucleotides is amplified (chromosome 5, + strand):

1   tcaacagtgt ctcctgctca gacccactgg tatcctcttg gcggcgcaag aggaaggagt
61  ctagcaacac agacagtgca ggagccctgg gcaccctcag gttgggggtc ctcactaagg
121 agggtgaatg ggagagacaa actttacctg ggtaaacttg ggctggcatg gggactccag
181 caccggctcc ctggaccaca ggttctgtgt gtttgggctg ggctcccgag cataccccca
241 cttctgtgcc tttgctcgag cggtggacac aaggctggag gagctgggcg gggagcgact
301 actgcagctg ggccaaggtg atgagctctg tggccaggag gaggctttcc gaggctgggc
361 ccaggccgcc ttccaggtga gctccccggt accctgtatc tgactggatc agcaccatgg
421 t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Moncada, S. (1992) The 1991 Ulf Von Euler Lecture. the L-Arginine: Nitric Oxide Pathway. Acta Physiol Scand. 145, 201-227.

  2. Huang, P. L., Huang, Z., Mashimo, H., Bloch, K. D., Moskowitz, M. A., Bevan, J. A., and Fishman, M. C. (1995) Hypertension in Mice Lacking the Gene for Endothelial Nitric Oxide Synthase. Nature. 377, 239-242.

  3. Liu, Y., and Feng, Q. (2012) NOing the Heart: Role of Nitric Oxide Synthase-3 in Heart Development. Differentiation. 84, 54-61.

  4. Bloch, W., Fleischmann, B. K., Lorke, D. E., Andressen, C., Hops, B., Hescheler, J., and Addicks, K. (1999) Nitric Oxide Synthase Expression and Role during Cardiomyogenesis. Cardiovasc Res. 43, 675-684.

  5. Kanno, S., Kim, P. K., Sallam, K., Lei, J., Billiar, T. R., and Shears, L. L.,2nd. (2004) Nitric Oxide Facilitates Cardiomyogenesis in Mouse Embryonic Stem Cells. Proc Natl Acad Sci U S A. 101, 12277-12281.

  6. Ji, G. J., Fleischmann, B. K., Bloch, W., Feelisch, M., Andressen, C., Addicks, K., and Hescheler, J. (1999) Regulation of the L-Type Ca2+ Channel during Cardiomyogenesis: Switch from NO to Adenylyl Cyclase-Mediated Inhibition. FASEB J. 13, 313-324.

  7. Xu, L., Eu, J. P., Meissner, G., and Stamler, J. S. (1998) Activation of the Cardiac Calcium Release Channel (Ryanodine Receptor) by Poly-S-Nitrosylation. Science. 279, 234-237.

  8. Campbell, D. L., Stamler, J. S., and Strauss, H. C. (1996) Redox Modulation of L-Type Calcium Channels in Ferret Ventricular Myocytes. Dual Mechanism Regulation by Nitric Oxide and S-Nitrosothiols. J Gen Physiol. 108, 277-293.

  9. Vila-Petroff, M. G., Younes, A., Egan, J., Lakatta, E. G., and Sollott, S. J. (1999) Activation of Distinct cAMP-Dependent and cGMP-Dependent Pathways by Nitric Oxide in Cardiac Myocytes. Circ Res. 84, 1020-1031.

  10. Mery, P. F., Pavoine, C., Belhassen, L., Pecker, F., and Fischmeister, R. (1993) Nitric Oxide Regulates Cardiac Ca2+ Current. Involvement of cGMP-Inhibited and cGMP-Stimulated Phosphodiesterases through Guanylyl Cyclase Activation. J Biol Chem. 268, 26286-26295.

  11. Willmott, N., Sethi, J. K., Walseth, T. F., Lee, H. C., White, A. M., and Galione, A. (1996) Nitric Oxide-Induced Mobilization of Intracellular Calcium Via the Cyclic ADP-Ribose Signaling Pathway. J Biol Chem. 271, 3699-3705.

  12. Ohashi, Y., Kawashima, S., Hirata, K., Yamashita, T., Ishida, T., Inoue, N., Sakoda, T., Kurihara, H., Yazaki, Y., and Yokoyama, M. (1998) Hypotension and Reduced Nitric Oxide-Elicited Vasorelaxation in Transgenic Mice Overexpressing Endothelial Nitric Oxide Synthase. J Clin Invest. 102, 2061-2071.

  13. Ortiz, P. A., and Garvin, J. L. (2002) Role of Nitric Oxide in the Regulation of Nephron Transport. Am J Physiol Renal Physiol. 282, F777-84.

  14. Plato, C. F., Shesely, E. G., and Garvin, J. L. (2000) ENOS Mediates L-Arginine-Induced Inhibition of Thick Ascending Limb Chloride Flux. Hypertension. 35, 319-323.

  15. Ortiz, P. A., Hong, N. J., and Garvin, J. L. (2001) NO Decreases Thick Ascending Limb Chloride Absorption by Reducing Na(+)-K(+)-2Cl(-) Cotransporter Activity. Am J Physiol Renal Physiol. 281, F819-25.

  16. Kim, J. W., Min, Y. G., Rhee, C. S., Lee, C. H., Koh, Y. Y., Rhyoo, C., Kwon, T. Y., and Park, S. W. (2001) Regulation of Mucociliary Motility by Nitric Oxide and Expression of Nitric Oxide Synthase in the Human Sinus Epithelial Cells. Laryngoscope. 111, 246-250.

  17. Aicher, A., Heeschen, C., and Dimmeler, S. (2004) The Role of NOS3 in Stem Cell Mobilization. Trends Mol Med. 10, 421-425.

  18. Aicher, A., Heeschen, C., Mildner-Rihm, C., Urbich, C., Ihling, C., Technau-Ihling, K., Zeiher, A. M., and Dimmeler, S. (2003) Essential Role of Endothelial Nitric Oxide Synthase for Mobilization of Stem and Progenitor Cells. Nat Med. 9, 1370-1376.

  19. Han, R. N., Babaei, S., Robb, M., Lee, T., Ridsdale, R., Ackerley, C., Post, M., and Stewart, D. J. (2004) Defective Lung Vascular Development and Fatal Respiratory Distress in Endothelial NO Synthase-Deficient Mice: A Model of Alveolar Capillary Dysplasia? Circ Res. 94, 1115-1123.

  20. Nakayama, T., Sato, W., Kosugi, T., Zhang, L., Campbell-Thompson, M., Yoshimura, A., Croker, B. P., Johnson, R. J., and Nakagawa, T. (2009) Endothelial Injury due to eNOS Deficiency Accelerates the Progression of Chronic Renal Disease in the Mouse. Am J Physiol Renal Physiol. 296, F317-27.

  21. Feng, Q., Song, W., Lu, X., Hamilton, J. A., Lei, M., Peng, T., and Yee, S. P. (2002) Development of Heart Failure and Congenital Septal Defects in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation. 106, 873-879.

  22. Zhao, H. J., Wang, S., Cheng, H., Zhang, M. Z., Takahashi, T., Fogo, A. B., Breyer, M. D., and Harris, R. C. (2006) Endothelial Nitric Oxide Synthase Deficiency Produces Accelerated Nephropathy in Diabetic Mice. J Am Soc Nephrol. 17, 2664-2669.

  23. Li, W., Mital, S., Ojaimi, C., Csiszar, A., Kaley, G., and Hintze, T. H. (2004) Premature Death and Age-Related Cardiac Dysfunction in Male eNOS-Knockout Mice. J Mol Cell Cardiol. 37, 671-680.

  24. Forbes, M. S., Thornhill, B. A., Park, M. H., and Chevalier, R. L. (2007) Lack of Endothelial Nitric-Oxide Synthase Leads to Progressive Focal Renal Injury. Am J Pathol. 170, 87-99.

  25. Lee, T. C., Zhao, Y. D., Courtman, D. W., and Stewart, D. J. (2000) Abnormal Aortic Valve Development in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation. 101, 2345-2348.

  26. Hatoum, O. A., Miura, H., and Binion, D. G. (2003) The Vascular Contribution in the Pathogenesis of Inflammatory Bowel Disease. Am J Physiol Heart Circ Physiol. 285, H1791-6.

  27. Palatka, K., Serfozo, Z., Vereb, Z., Hargitay, Z., Lontay, B., Erdodi, F., Banfalvi, G., Nemes, Z., Udvardy, M., and Altorjay, I. (2005) Changes in the Expression and Distribution of the Inducible and Endothelial Nitric Oxide Synthase in Mucosal Biopsy Specimens of Inflammatory Bowel Disease. Scand J Gastroenterol. 40, 670-680.

  28. Sasaki, M., Bharwani, S., Jordan, P., Elrod, J. W., Grisham, M. B., Jackson, T. H., Lefer, D. J., and Alexander, J. S. (2003) Increased Disease Activity in eNOS-Deficient Mice in Experimental Colitis. Free Radic Biol Med. 35, 1679-1687.

  29. Palatka, K., Serfozo, Z., Vereb, Z., Batori, R., Lontay, B., Hargitay, Z., Nemes, Z., Udvardy, M., Erdodi, F., and Altorjay, I. (2006) Effect of IBD Sera on Expression of Inducible and Endothelial Nitric Oxide Synthase in Human Umbilical Vein Endothelial Cells. World J Gastroenterol. 12, 1730-1738.

  30. Miller, M. J., Chotinaruemol, S., Sadowska-Krowicka, H., Kakkis, J. L., Munshi, U. K., Zhang, X. J., and Clark, D. A. (1993) Nitric Oxide: The Jekyll and Hyde of Gut Inflammation. Agents Actions. 39 Spec No, C180-2.

  31. Miller, M. J., Munshi, U. K., Sadowska-Krowicka, H., Kakkis, J. L., Zhang, X. J., Eloby-Childress, S., and Clark, D. A. (1994) Inhibition of Calcium-Dependent Nitric Oxide Synthase Causes Ileitis and Leukocytosis in Guinea Pigs. Dig Dis Sci. 39, 1185-1192.

  32. Kubes, P. (1992) Nitric Oxide Modulates Epithelial Permeability in the Feline Small Intestine. Am J Physiol. 262, G1138-42.