Phenotypic Mutation 'rsq2' (pdf version)
Allelersq2
Mutation Type missense
ChromosomeX
Coordinate167,307,945 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tlr7
Gene Name toll-like receptor 7
Synonym(s) RP23-139P21.3
Chromosomal Location 167,304,929-167,330,558 bp (-)
MGI Phenotype The innate immune response to viral infection is affected in homozygous null mice. Mice homozygous or hemizygous for a point mutation produce little or no tumor necrosis factor (TNF) alpha in response to stimulation by a single stranded RNA analog.
Accession Number

NCBI RefSeq: NM_133211; MGI: 3767244

Mapped Yes 
Amino Acid Change Asparagine changed to Tyrosine
Institutional SourceBeutler Lab
Ref Sequences
N182Y in Ensembl: ENSMUSP00000107787 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 35 69 5.03e-1 SMART
Blast:LRR 88 114 N/A BLAST
LRR 126 149 2.45e0 SMART
Blast:LRR 171 193 N/A BLAST
LRR 203 226 9.75e0 SMART
LRR_TYP 289 312 1.28e-3 SMART
LRR 313 337 2.08e1 SMART
Blast:LRR 339 363 N/A BLAST
LRR 396 419 9.22e0 SMART
Blast:LRR 420 441 N/A BLAST
LRR 497 516 1.09e2 SMART
Blast:LRR 517 541 N/A BLAST
LRR 542 565 4.97e0 SMART
Blast:LRR 566 589 N/A BLAST
LRR 596 619 2.76e2 SMART
LRR_TYP 650 673 1.72e-4 SMART
LRR_TYP 699 722 1.58e-3 SMART
LRR 724 746 8.26e1 SMART
LRR 749 770 2.15e2 SMART
LRRCT 784 835 1.56e-3 SMART
transmembrane domain 851 873 N/A INTRINSIC
Pfam:TIR 894 1033 5.3e-16 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.980 (Sensitivity: 0.74; Specificity: 0.96)
(Using Ensembl: ENSMUSP00000107787)
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(1) Chemically induced(2

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Tlr7 APN X 167308475 unclassified possibly damaging 0.94
IGL01064:Tlr7 APN X 167308211 unclassified probably damaging 1.00
IGL02940:Tlr7 APN X 167307834 unclassified probably benign 0.01
IGL03064:Tlr7 APN X 167306207 unclassified possibly damaging 0.89
IGL03298:Tlr7 APN X 167306707 unclassified probably benign 0.45
rsq1 UTSW X 167308286 missense probably damaging 1.00
rsq3 UTSW X 167307945 missense probably damaging 0.98
R1400:Tlr7 UTSW X 167307849 missense probably damaging 0.99
R1883:Tlr7 UTSW X 167306472 missense probably benign 0.35
R5929:Tlr7 UTSW X 167306882 missense probably damaging 1.00
Mode of Inheritance X-linked Recessive
Local Stock Sperm, gDNA
MMRRC Submission 030753-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 10/20/2008
Phenotypic Description
The rsq2 mutant was discovered in a screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for altered responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen).   Peritoneal macrophages from rsq2 mice fail to produce tumor necrosis factor (TNF)-α in response to R-848, a single stranded RNA mimetic that activates TLR7 (Figure 1).  However, TNF-α production is normal following stimulation with MALP-2 (macrophage-activating lipopeptide-2, TLR2/6 ligand), CpG oligodeoxynucleotides (CpG ODN, TLR9 ligand), Pam3CSK4 (a triacyl lipopeptide, TLR2/1 ligand), poly I:C (TLR3 ligand) and lipopolysaccharide (LPS, TLR4 ligand).
 
A second mutant with the same mutation, designated rsq3, was isolated independently as a descendant of a different ENU-mutagenized G0 male.  The current breeding strategy crosses G1 females from an original G0 to multiple other G0 mice in order to more quickly recover mutations (please see the FAQ page for a description of the breeding strategy).  Thus, It is likely that both the rsq2 and rsq3 mutants have a common G0 ancestor. 

 

Nature of Mutation
Figure 2. Protein and domain structure of TLR7. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the rsq2 mutation is shown in red. 3D image was created using UCSF Chimera. B) TLR7 is a 1050 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The rsq2 mutation (red asterisk) results in a conversion of asparagine to tyrosine at residue 182 of the TLR7 protein. This image is interactive. Click on the image to view other mutations found in TLR7 (red). Click on the mutations for more specific information.
The Tlr7 gene on the X chromosome of rsq2 mice was sequenced, and an A to T transversion was identified in exon 3 (of 3 total exons) at position 732 of the Tlr7 transcript. The mutation was identified in a hemizygous male.
 
721 CTCTACCTGGGTCAAAACTGTTATTATCGAAAT 
177 -L--Y--L--G--Q--N--C--Y--Y--R--N-
 
The mutated nucleotide is indicated in red lettering, and results in a conversion of asparagine to tyrosine at residue 182 of the TLR7 protein (Figure 2).
Protein Prediction
The rsq2 mutation results in the substitution of tyrosine for an asparagine at residue 182 of the TLR7 ectodomain.  This residue is highly conserved and is located in the fifth leucine-rich repeat (LRR) (1). 

 

Please see the record for rsq1 for information about Tlr7.

Putative Mechanism
The rsq2 mutation alters the tenth residue of the fifth TLR7 LRR.  The LRRs of the TLR proteins mediate ligand recognition and binding.  The first ten residues of all LRR subtypes contain a conserved leucine-rich motif  that typically ends in an asparagine, followed by a second leucine-rich motif that varies in length, sequence, and structure.  The fifth LRR of TLR7, along with LRRs 2 and 8, contain long insertions following the consensus asparagine.  These insertions, along with the insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues.  It is thought that these four insertions create the ligand-binding site (1).  Alteration of the asparagine residue in LRR5 of TLR7 is likely to affect the structure of the LRR and inhibit ligand-binding.  Although the effects of this mutation on TLR7 structure and function have not been directly tested, TLR7 signaling is severely reduced, if not completely abolished, in rsq2 mice.
Primers Primers cannot be located by automatic search.
Genotyping
Rsq2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  The same PCR primers are used as for rsq1 genotyping.
 
Primers for PCR amplification
Rsq1(F): 5’- AGCACTCTTCGCAGCAACTAATATGTAA -3’
Rsq1(R): 5’- CCAACTCAACAAGGTTGGGAAGAAAATG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             10:00
7) 4°C               ∞
 
Primers for sequencing
Rsq2_seq(F): 5’- GTGGACTCTCTGACTTAAAAGCC -3’
Rsq2_seq(R): 5’- ATGCAAAAATTTGGCCTCCTC -3’
 
The following sequence of 1911 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Tlr7) is amplified:
 
21166                                                  agcac tcttcgcagc
21181 aactaatatg taatgctgct tctgtatctt aaaaactgtt tggggcagca agagacatgg
21241 ctcagtgggt aagtatggtg atgtgaatgt gaatgacccc gtaggctcat gtttgaatac
21301 ttggttccca gtcagtggaa cttttggcaa ggattaggag gtgtggcttt gttgaaagag
21361 gtgtgccact agaggtaggc tgtgagattt caaaagtcca tgcccatccc agtctcattc
21421 cttctctgcc tacaatttgc agataacatg tgagctctca gcagctgctc cagtgtcatg
21481 cctacctgtc tgctaccatg tttcctgtca tgatatcata aactaaccct ctaaaactct
21541 aggcaagaac cagagcaaat gctttgtttt ctaaggtgtt gtggtcatag tggttcatca
21601 cagcaataga aacagtaatg agacagtaag tgtacttgtg gacaagactg atgacctgcg
21661 tttgatctgc aggatccaca aggtggaagg agataacaga ctctcacaag ttatcctctg
21721 accgccacaa tcacgtcatg gtatgtgcac actcactgac atatgcaaag catactcaca
21781 caagacaaat aaataaatgt gaaaaaattc ttgaagtttg ttagaaagct aagatggtac
21841 aagcaaaaca taaaaccatt atcaaagtct tcagtggtta ataagtacag tcacagggac
21901 ggaggtgctg tttacactat tacaaacaag acctgtgttg tttagtttta ataatgtacc
21961 aaaagagagg aaataaatgg aacttctcaa tcattccttg atatatttta taacaataat
22021 ttttttctct cttttattta caggtgtttt cgatgtggac acggaagaga caaattttga
22081 tctttttaaa tatgctctta gtttctagag tctttgggtt tcgatggttt cctaaaactc
22141 taccttgtga agttaaagta aatatcccag aggcccatgt gatcgtggac tgcacagaca
22201 agcatttgac agaaatccct gagggcattc ccactaacac caccaatctt acccttacca
22261 tcaaccacat accaagcatc tctccagatt ccttccgtag gctgaaccat ctggaagaaa
22321 tcgatttaag atgcaattgt gtacctgttc tactggggtc caaagccaat gtgtgtacca
22381 agaggctgca gattagacct ggaagcttta gtggactctc tgacttaaaa gccctttacc
22441 tggatggaaa ccaacttctg gagataccac aggatctgcc atccagctta catcttctga
22501 gccttgaggc taacaacatc ttctccatca cgaaggagaa tctaacagaa ctggtcaaca
22561 ttgaaacact ctacctgggt caaaactgtt attatcgaaa tccttgcaat gtttcctatt
22621 ctattgaaaa agatgctttc ctagttatga gaaatttgaa ggttctctca ctaaaagata
22681 acaatgtcac agctgtcccc accactttgc cacctaattt actagagctc tatctttata
22741 acaatatcat taagaaaatc caagaaaatg attttaataa cctcaatgag ttgcaagttc
22801 ttgacctaag tggaaattgc cctcgatgtt ataatgtccc atatccgtgt acaccgtgtg
22861 aaaataattc ccccttacag atccatgaca atgctttcaa ttcattgaca gaattaaaag
22921 ttttacgttt acacagtaat tctcttcagc atgtgccccc aacatggttt aaaaacatga
22981 gaaacctcca ggaactagac ctctcccaaa actacttggc cagagaaatt gaggaggcca
23041 aatttttgca ttttcttccc aaccttgttg agttgg
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.
References
Science Writers Nora G. Smart
AuthorsOwen M. Siggs, Bruce Beutler
Edit History
01/28/2011 6:56 PM (current)
11/08/2010 11:44 AM
06/28/2010 9:34 AM
02/03/2010 4:47 PM