Incidental Mutation 'R1323:Gm813'
ID157744
Institutional Source Beutler Lab
Gene Symbol Gm813
Ensembl Gene ENSMUSG00000075002
Gene Namepredicted gene 813
SynonymsLOC385656, LOC328695
MMRRC Submission 039389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1323 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58613675-58616978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58616915 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000097255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099663
AA Change: P10L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097255
Gene: ENSMUSG00000075002
AA Change: P10L

DomainStartEndE-ValueType
Pfam:Ferritin 14 152 7.4e-16 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.6%
  • 10x: 89.2%
  • 20x: 70.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,290,937 F933L possibly damaging Het
Abcc8 T G 7: 46,117,362 Q998P probably benign Het
Akr1e1 C T 13: 4,607,548 G17E probably damaging Het
D630045J12Rik T C 6: 38,148,508 I1524V probably damaging Het
Elovl1 T C 4: 118,431,654 L103P possibly damaging Het
Fam171a2 T G 11: 102,444,125 D62A probably damaging Het
Frzb G A 2: 80,413,376 P320S probably benign Het
Fsip2 G T 2: 82,985,752 G3943V probably damaging Het
Grm8 A G 6: 28,125,974 L51P probably damaging Het
Hist1h2al T G 13: 51,203,064 noncoding transcript Het
Hnf4g T C 3: 3,634,221 S4P possibly damaging Het
Megf8 T A 7: 25,360,102 probably null Het
Mtnr1b A G 9: 15,863,136 F209S probably damaging Het
Nckipsd G A 9: 108,812,579 R313Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Paqr5 C T 9: 61,961,528 probably null Het
S100a14 T C 3: 90,527,736 V18A probably damaging Het
Sycp2 A T 2: 178,347,621 S1441R possibly damaging Het
Vmn2r101 G A 17: 19,612,051 D770N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp600 A G 4: 146,196,691 Y643C probably damaging Het
Other mutations in Gm813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02701:Gm813 APN 16 58615807 missense probably benign 0.00
IGL02839:Gm813 APN 16 58615847 missense probably damaging 1.00
IGL03275:Gm813 APN 16 58615756 missense probably damaging 1.00
R0946:Gm813 UTSW 16 58614712 missense probably damaging 1.00
R1323:Gm813 UTSW 16 58616915 missense possibly damaging 0.65
R1548:Gm813 UTSW 16 58615839 missense probably benign 0.06
R2382:Gm813 UTSW 16 58615876 intron probably null
R2871:Gm813 UTSW 16 58613979 missense probably benign 0.39
R2871:Gm813 UTSW 16 58613979 missense probably benign 0.39
R2873:Gm813 UTSW 16 58613979 missense probably benign 0.39
R2874:Gm813 UTSW 16 58613979 missense probably benign 0.39
R4690:Gm813 UTSW 16 58613970 missense probably benign 0.00
R5097:Gm813 UTSW 16 58613864 missense probably benign 0.15
R5822:Gm813 UTSW 16 58615712 critical splice donor site probably null
R6234:Gm813 UTSW 16 58614671 missense probably benign 0.01
R6382:Gm813 UTSW 16 58613910 missense possibly damaging 0.73
R7170:Gm813 UTSW 16 58615728 nonsense probably null
R8119:Gm813 UTSW 16 58616848 missense probably benign 0.00
RF016:Gm813 UTSW 16 58616867 missense probably damaging 1.00
X0026:Gm813 UTSW 16 58613959 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGCCTCGCCATTGAACTACCTTC -3'
(R):5'- TCTGTCTGCTCACAAGGCCAAC -3'

Sequencing Primer
(F):5'- ATGTGAAGATGTGAATGTTAGATACC -3'
(R):5'- GTATATCAAGCAGGCTATGCCATC -3'
Posted On2014-02-18