Mutagenetix > Incidental Mutation

Incidental Mutation 'R2998:Or5al7'

257213

Institutional Source

Beutler Lab

Gene Symbol

Or5al7

Ensembl Gene

ENSMUSG00000075201

Gene Name

olfactory receptor family 5 subfamily AL member 7

Synonyms

MOR185-7, GA_x6K02T2Q125-47631900-47630956, Olfr1043

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R2998 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85992347-85993291 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85992364 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 310 (I310L)

Ref Sequence

ENSEMBL: ENSMUSP00000149716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]

AlphaFold

Q8VFK4

Predicted Effect

probably benign
Transcript: ENSMUST00000099907
AA Change: I310L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201
AA Change: I310L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	6.9e-46	PFAM
Pfam:7tm_1	41	290	1.5e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099908

SMART Domains

Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1.2e-48	PFAM
Pfam:7tm_1	41	290	1.3e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213886
AA Change: I310L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213949
AA Change: I310L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215624

Predicted Effect

probably benign
Transcript: ENSMUST00000216028
AA Change: I310L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 10 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
C3	T	A	17: 57,517,284 (GRCm39)	T1284S	probably benign	Het
Fggy	T	C	4: 95,737,822 (GRCm39)	C140R	probably benign	Het
Klk1b26	A	T	7: 43,666,222 (GRCm39)	I222F	probably benign	Het
Piwil2	A	T	14: 70,648,687 (GRCm39)	C251S	probably damaging	Het
Pop7	T	C	5: 137,500,225 (GRCm39)	D36G	probably damaging	Het
Rad51b	T	A	12: 79,349,263 (GRCm39)	L33H	probably damaging	Het
Rtl1	T	C	12: 109,561,530 (GRCm39)	E103G	probably damaging	Het
Slc13a2	T	C	11: 78,295,611 (GRCm39)	D85G	probably damaging	Het
Stat1	T	A	1: 52,190,408 (GRCm39)	N548K	probably benign	Het
Uggt2	A	T	14: 119,286,797 (GRCm39)	Y683N	probably damaging	Het

Other mutations in Or5al7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Or5al7	APN	2	85,993,264 (GRCm39)	missense	probably benign	0.01
IGL02037:Or5al7	APN	2	85,993,181 (GRCm39)	missense	probably benign
IGL02174:Or5al7	APN	2	85,992,442 (GRCm39)	missense	possibly damaging	0.78
IGL02511:Or5al7	APN	2	85,992,363 (GRCm39)	missense	probably benign	0.00
IGL02578:Or5al7	APN	2	85,993,073 (GRCm39)	nonsense	probably null
IGL03084:Or5al7	APN	2	85,992,569 (GRCm39)	nonsense	probably null
R0278:Or5al7	UTSW	2	85,992,923 (GRCm39)	nonsense	probably null
R0633:Or5al7	UTSW	2	85,992,435 (GRCm39)	missense	probably damaging	1.00
R0972:Or5al7	UTSW	2	85,992,648 (GRCm39)	missense	possibly damaging	0.94
R1033:Or5al7	UTSW	2	85,993,194 (GRCm39)	missense	possibly damaging	0.67
R2116:Or5al7	UTSW	2	85,993,073 (GRCm39)	nonsense	probably null
R3951:Or5al7	UTSW	2	85,992,962 (GRCm39)	nonsense	probably null
R5147:Or5al7	UTSW	2	85,992,378 (GRCm39)	missense	possibly damaging	0.79
R6193:Or5al7	UTSW	2	85,992,628 (GRCm39)	missense	possibly damaging	0.94
R7020:Or5al7	UTSW	2	85,992,363 (GRCm39)	missense	probably benign	0.00
R7954:Or5al7	UTSW	2	85,993,212 (GRCm39)	missense	probably damaging	0.99
R8203:Or5al7	UTSW	2	85,992,844 (GRCm39)	missense	probably benign
R8390:Or5al7	UTSW	2	85,993,266 (GRCm39)	missense	possibly damaging	0.82
Z1177:Or5al7	UTSW	2	85,992,508 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACACTCAAGGACTTTGTTTCTAC -3'
(R):5'- AGAAAGTCTTCTCCACCTGTGC -3'

Sequencing Primer
(F):5'- TCAAGGACTTTGTTTCTACTTATCAC -3'
(R):5'- AAAGTCTTCTCCACCTGTGCTTCTC -3'

Posted On

2015-01-11