Incidental Mutation 'V7732:Ggh'
ID44029
Institutional Source Beutler Lab
Gene Symbol Ggh
Ensembl Gene ENSMUSG00000073987
Gene Namegamma-glutamyl hydrolase
Synonymsgamma-GH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #V7732 () of strain may
Quality Score153
Status Validated (trace)
Chromosome4
Chromosomal Location20042052-20066750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20046225 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 44 (F44L)
Ref Sequence ENSEMBL: ENSMUSP00000095843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098242]
Predicted Effect probably benign
Transcript: ENSMUST00000098242
AA Change: F44L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095843
Gene: ENSMUSG00000073987
AA Change: F44L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Peptidase_C26 34 245 4.9e-25 PFAM
Pfam:GATase 50 253 2.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180742
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.9%
  • 20x: 90.3%
Validation Efficiency 96% (25/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene catalyzes the hydrolysis of folylpoly-gamma-glutamates and antifolylpoly-gamma-glutamates by the removal of gamma-linked polyglutamates and glutamate. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,283,541 F793L probably benign Het
Atmin C T 8: 116,956,479 P293S probably damaging Het
Card11 G A 5: 140,876,495 R1016* probably null Het
Cep89 A G 7: 35,403,098 S79G probably damaging Het
Cic T C 7: 25,292,245 V2227A probably benign Het
Clcn6 A G 4: 148,013,955 V534A probably damaging Het
Dpep2 T A 8: 105,989,260 H124L probably damaging Het
Elfn1 G A 5: 139,971,439 R66Q probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gpr37 T C 6: 25,669,123 Y574C probably benign Het
Heatr5a C A 12: 51,905,324 A1178S possibly damaging Het
Igsf9 A G 1: 172,490,393 T106A probably benign Het
Itpr3 G T 17: 27,111,024 probably benign Het
Itpr3 G C 17: 27,111,026 probably null Het
Nlrp6 G A 7: 140,926,648 probably benign Het
Rabac1 T A 7: 24,972,219 Q51L probably damaging Het
Rgma A G 7: 73,417,320 T108A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sarm1 T A 11: 78,488,065 T385S probably benign Het
Spata17 T C 1: 187,048,480 T357A possibly damaging Het
Ufl1 T C 4: 25,251,368 I711V probably damaging Het
Vwa3a A G 7: 120,778,949 probably benign Het
Other mutations in Ggh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Ggh APN 4 20057965 missense probably benign 0.02
IGL03057:Ggh APN 4 20065770 missense probably benign 0.00
R0006:Ggh UTSW 4 20054155 missense possibly damaging 0.95
R1539:Ggh UTSW 4 20054204 critical splice donor site probably null
R4532:Ggh UTSW 4 20046225 missense probably benign
R6431:Ggh UTSW 4 20042219 missense unknown
R7538:Ggh UTSW 4 20049833 missense probably damaging 0.98
R7539:Ggh UTSW 4 20049833 missense probably damaging 0.98
R7594:Ggh UTSW 4 20049833 missense probably damaging 0.98
R7595:Ggh UTSW 4 20049833 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAACTCAGATGGTCCTTCCCCAATAC -3'
(R):5'- TTGTGGCTGAAATCAGATGCAACAAC -3'

Sequencing Primer
(F):5'- CTTTCCCAACAACTGTGGGTAAAC -3'
(R):5'- CAGATGCAACAACACTCCTTTTAATG -3'
Posted On2013-05-31