Incidental Mutation 'R1255:Acsf3'
ID151420
Institutional Source Beutler Lab
Gene Symbol Acsf3
Ensembl Gene ENSMUSG00000015016
Gene Nameacyl-CoA synthetase family member 3
Synonyms
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1255 (G1)
Quality Score193
Status Not validated
Chromosome8
Chromosomal Location122775486-122817880 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 122785966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015160] [ENSMUST00000015160] [ENSMUST00000127664] [ENSMUST00000212781] [ENSMUST00000212781] [ENSMUST00000212790]
Predicted Effect probably null
Transcript: ENSMUST00000015160
SMART Domains Protein: ENSMUSP00000015160
Gene: ENSMUSG00000015016

DomainStartEndE-ValueType
Pfam:AMP-binding 47 478 3.9e-86 PFAM
Pfam:AMP-binding_C 486 561 6.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000015160
SMART Domains Protein: ENSMUSP00000015160
Gene: ENSMUSG00000015016

DomainStartEndE-ValueType
Pfam:AMP-binding 47 478 3.9e-86 PFAM
Pfam:AMP-binding_C 486 561 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212781
Predicted Effect probably null
Transcript: ENSMUST00000212781
Predicted Effect probably null
Transcript: ENSMUST00000212790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212903
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Acsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsf3 APN 8 122780642 splice site probably benign
IGL01930:Acsf3 APN 8 122780346 missense probably benign 0.03
IGL02064:Acsf3 APN 8 122780247 missense possibly damaging 0.74
IGL02321:Acsf3 APN 8 122780114 missense possibly damaging 0.57
IGL02342:Acsf3 APN 8 122817498 missense probably benign 0.03
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0566:Acsf3 UTSW 8 122781527 missense possibly damaging 0.95
R1836:Acsf3 UTSW 8 122780183 missense probably damaging 0.99
R1886:Acsf3 UTSW 8 122784002 missense probably damaging 1.00
R1977:Acsf3 UTSW 8 122781533 missense probably damaging 1.00
R2204:Acsf3 UTSW 8 122813644 missense probably damaging 0.98
R4735:Acsf3 UTSW 8 122781479 missense probably damaging 1.00
R4795:Acsf3 UTSW 8 122780157 missense possibly damaging 0.59
R4850:Acsf3 UTSW 8 122817436 missense probably damaging 1.00
R5092:Acsf3 UTSW 8 122817392 missense probably benign 0.12
R5435:Acsf3 UTSW 8 122780281 missense probably damaging 1.00
R6115:Acsf3 UTSW 8 122790672 missense probably damaging 1.00
R6147:Acsf3 UTSW 8 122781474 missense probably damaging 1.00
R6283:Acsf3 UTSW 8 122785955 missense probably damaging 1.00
R6848:Acsf3 UTSW 8 122790590 missense probably damaging 1.00
R7268:Acsf3 UTSW 8 122790662 missense probably benign 0.16
R7291:Acsf3 UTSW 8 122813577 missense probably benign 0.03
R7319:Acsf3 UTSW 8 122813031 missense probably damaging 1.00
R7350:Acsf3 UTSW 8 122785946 missense probably benign 0.00
R7402:Acsf3 UTSW 8 122780424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAAGCCCCTATGTTGTGCTG -3'
(R):5'- AGTTTGGAATGAGCACCCTGCTATC -3'

Sequencing Primer
(F):5'- CACTGCTGGAGAAGTGGAG -3'
(R):5'- GAGCACCCTGCTATCTTCCC -3'
Posted On2014-01-29