Incidental Mutation 'R1347:Glyr1'
ID156543
Institutional Source Beutler Lab
Gene Symbol Glyr1
Ensembl Gene ENSMUSG00000022536
Gene Nameglyoxylate reductase 1 homolog (Arabidopsis)
Synonyms3930401K13Rik, Npac, 2810419J22Rik
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location5013909-5049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5021339 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 338 (D338G)
Ref Sequence ENSEMBL: ENSMUSP00000111510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000115844]
Predicted Effect probably benign
Transcript: ENSMUST00000023189
AA Change: D332G

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536
AA Change: D332G

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115844
AA Change: D338G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536
AA Change: D338G

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231132
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.4%
  • 10x: 88.6%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Spata31d1c C T 13: 65,035,388 T248I probably benign Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Glyr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Glyr1 APN 16 5020288 missense probably benign
IGL02332:Glyr1 APN 16 5018953 missense probably damaging 1.00
IGL02407:Glyr1 APN 16 5036948 missense probably benign 0.01
IGL02429:Glyr1 APN 16 5019376 missense probably benign 0.28
IGL03255:Glyr1 APN 16 5048757 unclassified probably null
R0020:Glyr1 UTSW 16 5037049 missense probably damaging 1.00
R0309:Glyr1 UTSW 16 5031972 missense probably damaging 0.98
R0694:Glyr1 UTSW 16 5026560 missense probably damaging 0.99
R0971:Glyr1 UTSW 16 5021345 frame shift probably null
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1382:Glyr1 UTSW 16 5021345 frame shift probably null
R1383:Glyr1 UTSW 16 5021345 frame shift probably null
R2137:Glyr1 UTSW 16 5018482 missense probably benign 0.01
R2254:Glyr1 UTSW 16 5019013 missense probably benign 0.01
R3913:Glyr1 UTSW 16 5031913 missense probably damaging 1.00
R4112:Glyr1 UTSW 16 5018486 missense possibly damaging 0.83
R4629:Glyr1 UTSW 16 5037043 missense possibly damaging 0.70
R4795:Glyr1 UTSW 16 5047758 missense probably benign 0.40
R5112:Glyr1 UTSW 16 5018876 nonsense probably null
R5412:Glyr1 UTSW 16 5036433 missense possibly damaging 0.87
R5757:Glyr1 UTSW 16 5018992 missense probably benign 0.30
R6425:Glyr1 UTSW 16 5036486 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGACAAAAGAAAGGCACACTCAG -3'
(R):5'- GAAATCAGACAGGGGCATACACATCTC -3'

Sequencing Primer
(F):5'- AGTCCAGCTCAGTAGAATTCCTG -3'
(R):5'- GGCATACACATCTCTGGCCTG -3'
Posted On2014-02-11