Incidental Mutation 'R1423:Pcdhb15'
ID161194
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Nameprotocadherin beta 15
SynonymsPcdhbO, Pcdhb7
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37473540-37476340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37473922 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 69 (D69V)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050034
AA Change: D69V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: D69V

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37475154 missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37474993 missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37474261 missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37474038 missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37475502 missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37473957 missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37475220 missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37473850 missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37475671 missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37475276 missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37475398 missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37474168 missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37475895 missense probably benign
R0554:Pcdhb15 UTSW 18 37474519 missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37475566 missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37474621 missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37473762 missense probably benign 0.01
R1672:Pcdhb15 UTSW 18 37474660 missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37473813 missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37476031 missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37475443 missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37475389 missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37474389 missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37473757 missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37475890 missense probably benign 0.00
R4432:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4433:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37475575 missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37475595 missense probably damaging 0.96
R4988:Pcdhb15 UTSW 18 37475802 missense probably damaging 0.98
R5635:Pcdhb15 UTSW 18 37473770 nonsense probably null
R5692:Pcdhb15 UTSW 18 37474449 missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37474767 missense probably damaging 0.99
R5913:Pcdhb15 UTSW 18 37474654 missense probably benign 0.07
R6350:Pcdhb15 UTSW 18 37475361 missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37474261 missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37474807 missense possibly damaging 0.60
R6693:Pcdhb15 UTSW 18 37474341 missense probably benign 0.01
R6905:Pcdhb15 UTSW 18 37474695 missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37475568 missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37474336 missense probably damaging 1.00
X0062:Pcdhb15 UTSW 18 37476015 nonsense probably null
X0063:Pcdhb15 UTSW 18 37475084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGAGCTGCTTGAGGCTAAATG -3'
(R):5'- TGCCCTTTCCAAGAGAAGCGTC -3'

Sequencing Primer
(F):5'- CCAGATTGGAACAAGCTGTGC -3'
(R):5'- GCCCCTGGAGTGGTACTTTC -3'
Posted On2014-03-14