Incidental Mutation 'R1388:Ccdc38'
ID162502
Institutional Source Beutler Lab
Gene Symbol Ccdc38
Ensembl Gene ENSMUSG00000036168
Gene Namecoiled-coil domain containing 38
Synonyms
MMRRC Submission 039450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1388 (G1)
Quality Score168
Status Validated
Chromosome10
Chromosomal Location93540632-93584327 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 93581840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020203] [ENSMUST00000092215] [ENSMUST00000132214]
Predicted Effect probably benign
Transcript: ENSMUST00000020203
SMART Domains Protein: ENSMUSP00000020203
Gene: ENSMUSG00000020018

DomainStartEndE-ValueType
Sm 9 74 6.54e-25 SMART
low complexity region 76 86 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092215
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168

DomainStartEndE-ValueType
Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132214
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,049 T109K probably damaging Het
Acot3 T G 12: 84,058,987 H409Q possibly damaging Het
Adgra1 T C 7: 139,874,003 V152A probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccdc174 C A 6: 91,881,244 probably null Het
Clca4b A T 3: 144,916,654 V550D probably benign Het
Dab2ip C T 2: 35,721,256 probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm2959 A T 14: 42,413,703 noncoding transcript Het
Gmnc A G 16: 26,963,912 L80P probably damaging Het
Gtf2ird1 T C 5: 134,395,710 D394G probably damaging Het
Heatr1 T C 13: 12,417,447 probably benign Het
Il1a T C 2: 129,306,581 S70G possibly damaging Het
Kctd19 T C 8: 105,392,051 S293G probably null Het
Klra4 T C 6: 130,062,235 probably benign Het
Mr1 T C 1: 155,132,503 E242G probably damaging Het
Mrnip C A 11: 50,196,945 A98E probably benign Het
Mybpc3 C T 2: 91,122,874 P155S probably benign Het
Myh14 A T 7: 44,665,122 Y126N probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr218 T C 1: 173,203,878 V174A probably benign Het
Olfr979 A G 9: 40,000,652 S192P probably damaging Het
Pnisr T C 4: 21,862,041 M243T possibly damaging Het
Ptprr A G 10: 116,273,752 S633G probably benign Het
Rasip1 T A 7: 45,630,232 S300T probably damaging Het
Sbsn A T 7: 30,752,151 H197L probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sim1 T A 10: 50,895,994 I33N probably damaging Het
Speg A G 1: 75,430,460 D2878G probably damaging Het
Taf2 T A 15: 55,036,625 N864I probably benign Het
Tmem43 G T 6: 91,478,803 probably null Het
Ttn T C 2: 76,711,791 E25290G probably damaging Het
Ush2a A G 1: 188,523,318 probably benign Het
Usp53 T C 3: 122,957,628 E260G probably damaging Het
Vmn2r12 T G 5: 109,092,974 Y91S possibly damaging Het
Vmn2r59 A T 7: 42,045,709 N426K probably benign Het
Whamm C A 7: 81,586,290 L414I probably damaging Het
Zfhx4 A G 3: 5,401,387 T2227A probably damaging Het
Zfp866 C T 8: 69,766,184 R262Q probably benign Het
Other mutations in Ccdc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Ccdc38 APN 10 93569935 critical splice donor site probably null
IGL01986:Ccdc38 APN 10 93579843 missense probably damaging 1.00
IGL02396:Ccdc38 APN 10 93574132 missense possibly damaging 0.61
IGL02568:Ccdc38 APN 10 93579823 missense probably damaging 1.00
ANU23:Ccdc38 UTSW 10 93569935 critical splice donor site probably null
R0004:Ccdc38 UTSW 10 93574102 missense probably damaging 1.00
R0194:Ccdc38 UTSW 10 93565912 nonsense probably null
R0371:Ccdc38 UTSW 10 93562812 nonsense probably null
R1374:Ccdc38 UTSW 10 93582434 splice site probably benign
R1546:Ccdc38 UTSW 10 93565879 missense probably benign 0.01
R2377:Ccdc38 UTSW 10 93574035 missense probably damaging 1.00
R2419:Ccdc38 UTSW 10 93548975 missense probably benign 0.23
R3949:Ccdc38 UTSW 10 93550219 missense probably damaging 1.00
R5592:Ccdc38 UTSW 10 93550202 missense possibly damaging 0.58
R5652:Ccdc38 UTSW 10 93555586 splice site probably null
R5857:Ccdc38 UTSW 10 93562833 missense possibly damaging 0.67
R5918:Ccdc38 UTSW 10 93570886 nonsense probably null
R5919:Ccdc38 UTSW 10 93578838 missense possibly damaging 0.95
R6057:Ccdc38 UTSW 10 93581746 missense probably damaging 1.00
R6293:Ccdc38 UTSW 10 93562797 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGCAATCCACTCAGGTGATG -3'
(R):5'- AGAGACCTGTAGTTCATACCTGCCC -3'

Sequencing Primer
(F):5'- agggaagcagaggcagg -3'
(R):5'- AGTTCATACCTGCCCCTCCC -3'
Posted On2014-03-17