Incidental Mutation 'R1388:Rasip1'
ID162495
Institutional Source Beutler Lab
Gene Symbol Rasip1
Ensembl Gene ENSMUSG00000044562
Gene NameRas interacting protein 1
SynonymsRain, 2610025P08Rik
MMRRC Submission 039450-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1388 (G1)
Quality Score205
Status Validated
Chromosome7
Chromosomal Location45627488-45639093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45630232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 300 (S300T)
Ref Sequence ENSEMBL: ENSMUSP00000062429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033100] [ENSMUST00000057927]
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057927
AA Change: S300T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062429
Gene: ENSMUSG00000044562
AA Change: S300T

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 59 67 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
RA 141 253 6.94e-8 SMART
low complexity region 284 308 N/A INTRINSIC
low complexity region 310 326 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
SCOP:d1gxca_ 391 484 1e-2 SMART
low complexity region 498 509 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
DIL 768 877 4.14e-44 SMART
low complexity region 928 947 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211418
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation exhibit complete embryonic lethality during organogenesis associated with a failure in cardiovascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,049 T109K probably damaging Het
Acot3 T G 12: 84,058,987 H409Q possibly damaging Het
Adgra1 T C 7: 139,874,003 V152A probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccdc174 C A 6: 91,881,244 probably null Het
Ccdc38 A T 10: 93,581,840 probably benign Het
Clca4b A T 3: 144,916,654 V550D probably benign Het
Dab2ip C T 2: 35,721,256 probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm2959 A T 14: 42,413,703 noncoding transcript Het
Gmnc A G 16: 26,963,912 L80P probably damaging Het
Gtf2ird1 T C 5: 134,395,710 D394G probably damaging Het
Heatr1 T C 13: 12,417,447 probably benign Het
Il1a T C 2: 129,306,581 S70G possibly damaging Het
Kctd19 T C 8: 105,392,051 S293G probably null Het
Klra4 T C 6: 130,062,235 probably benign Het
Mr1 T C 1: 155,132,503 E242G probably damaging Het
Mrnip C A 11: 50,196,945 A98E probably benign Het
Mybpc3 C T 2: 91,122,874 P155S probably benign Het
Myh14 A T 7: 44,665,122 Y126N probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr218 T C 1: 173,203,878 V174A probably benign Het
Olfr979 A G 9: 40,000,652 S192P probably damaging Het
Pnisr T C 4: 21,862,041 M243T possibly damaging Het
Ptprr A G 10: 116,273,752 S633G probably benign Het
Sbsn A T 7: 30,752,151 H197L probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sim1 T A 10: 50,895,994 I33N probably damaging Het
Speg A G 1: 75,430,460 D2878G probably damaging Het
Taf2 T A 15: 55,036,625 N864I probably benign Het
Tmem43 G T 6: 91,478,803 probably null Het
Ttn T C 2: 76,711,791 E25290G probably damaging Het
Ush2a A G 1: 188,523,318 probably benign Het
Usp53 T C 3: 122,957,628 E260G probably damaging Het
Vmn2r12 T G 5: 109,092,974 Y91S possibly damaging Het
Vmn2r59 A T 7: 42,045,709 N426K probably benign Het
Whamm C A 7: 81,586,290 L414I probably damaging Het
Zfhx4 A G 3: 5,401,387 T2227A probably damaging Het
Zfp866 C T 8: 69,766,184 R262Q probably benign Het
Other mutations in Rasip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Rasip1 APN 7 45636764 nonsense probably null
IGL01995:Rasip1 APN 7 45636816 missense probably damaging 0.99
R0208:Rasip1 UTSW 7 45632575 missense probably damaging 0.97
R0373:Rasip1 UTSW 7 45635244 missense possibly damaging 0.50
R0869:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0870:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0871:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R0872:Rasip1 UTSW 7 45635028 missense probably damaging 0.99
R1780:Rasip1 UTSW 7 45635318 missense possibly damaging 0.94
R2348:Rasip1 UTSW 7 45629083 critical splice donor site probably null
R2517:Rasip1 UTSW 7 45634823 missense probably damaging 1.00
R4587:Rasip1 UTSW 7 45632735 missense possibly damaging 0.86
R4678:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4679:Rasip1 UTSW 7 45627823 missense possibly damaging 0.86
R4714:Rasip1 UTSW 7 45632396 frame shift probably null
R5572:Rasip1 UTSW 7 45636729 missense probably benign 0.00
R6182:Rasip1 UTSW 7 45628455 small deletion probably benign
R7443:Rasip1 UTSW 7 45638724 missense probably damaging 1.00
X0018:Rasip1 UTSW 7 45638868 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCAGGCAAAACCAATGTCCAGAG -3'
(R):5'- AGTGCTAACCTGAGCATCCTGGTAG -3'

Sequencing Primer
(F):5'- CAATGTCCAGAGTTAACAGTCTGTG -3'
(R):5'- TGAGTCAACTGATCGAAGTCTCC -3'
Posted On2014-03-17