Incidental Mutation 'R1483:Rp1l1'
ID165727
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 039536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R1483 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64029047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 694 (T694I)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058229
AA Change: T694I

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: T694I

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,903 S368T probably damaging Het
9930021J03Rik G A 19: 29,719,345 P916L possibly damaging Het
Adam12 T A 7: 133,930,025 T494S probably benign Het
Akap6 C T 12: 52,796,087 P73S probably damaging Het
Amotl2 A T 9: 102,730,897 T763S probably benign Het
C87499 T A 4: 88,628,834 Q116L probably damaging Het
Cdc5l A T 17: 45,408,364 V541D possibly damaging Het
Chl1 A G 6: 103,647,287 Y52C probably damaging Het
D6Wsu163e A G 6: 126,954,770 E255G probably benign Het
Ddhd2 A G 8: 25,753,128 S126P probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Drc3 A G 11: 60,388,889 I427V probably benign Het
Drg2 T C 11: 60,459,527 I104T probably damaging Het
Dst C T 1: 34,252,998 A932V probably damaging Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Eif3a A T 19: 60,768,726 D880E unknown Het
Elf1 T A 14: 79,580,638 D569E probably benign Het
Esp6 T A 17: 40,562,925 M1K probably null Het
Fer1l6 T C 15: 58,637,970 V1427A possibly damaging Het
Gm17689 G A 9: 36,581,324 S95L probably benign Het
Gsta1 A T 9: 78,242,493 K196M probably damaging Het
Gzme T A 14: 56,118,712 I110F probably damaging Het
H2-DMa T A 17: 34,135,750 V27E possibly damaging Het
H2-T10 A T 17: 36,121,146 S2T probably benign Het
Hadhb A G 5: 30,169,494 probably null Het
Hoxa11 G T 6: 52,243,456 D282E probably damaging Het
Ifit1bl1 A G 19: 34,594,641 Y139H possibly damaging Het
Ift27 A G 15: 78,165,236 V88A possibly damaging Het
Knop1 C T 7: 118,853,050 A149T probably damaging Het
Macf1 T A 4: 123,510,977 K597I probably damaging Het
Med16 A T 10: 79,903,100 I284N possibly damaging Het
Melk T A 4: 44,308,937 I98K probably damaging Het
Mst1 G T 9: 108,081,650 G127V probably benign Het
Nacad A G 11: 6,602,217 S325P probably damaging Het
Nbea G A 3: 56,002,790 P1328L probably benign Het
Nek5 C T 8: 22,096,790 S335N probably benign Het
Nif3l1 C A 1: 58,447,726 R24S probably benign Het
Nlrp14 T G 7: 107,190,122 N39K possibly damaging Het
Nup50 T A 15: 84,939,727 V427D probably damaging Het
Nwd1 C T 8: 72,657,086 P78L probably damaging Het
Olfr1431 T A 19: 12,209,750 Y61* probably null Het
Pnkd A G 1: 74,349,391 Y242C probably benign Het
Ppm1g T C 5: 31,203,121 D423G probably benign Het
Prkci A T 3: 31,043,792 N464Y probably damaging Het
Ptprf C T 4: 118,235,964 V494M possibly damaging Het
Rapgef4 T G 2: 72,055,026 probably null Het
Rbak T C 5: 143,174,344 E318G probably damaging Het
Rora A G 9: 69,364,385 D215G probably benign Het
Scrib A G 15: 76,057,922 L1032P probably damaging Het
Sectm1b G A 11: 121,055,826 T81M probably benign Het
Sgk3 T C 1: 9,872,293 F97L possibly damaging Het
Socs3 A T 11: 117,967,568 Y221* probably null Het
Tdrd6 T A 17: 43,627,607 H850L probably benign Het
Tex44 G T 1: 86,427,186 Q272H probably damaging Het
Tgfbr2 A C 9: 116,109,557 S426A probably benign Het
Tmem39b T C 4: 129,676,663 Y461C probably damaging Het
Ttn T A 2: 76,724,993 D30556V probably damaging Het
Tubgcp5 T A 7: 55,825,707 probably null Het
Vmn2r70 T C 7: 85,559,167 I701V probably benign Het
Vps39 A T 2: 120,323,648 L622Q probably damaging Het
Wdfy4 T A 14: 33,100,966 H1347L probably benign Het
Xpo1 A G 11: 23,284,863 I540V probably benign Het
Xylt2 A C 11: 94,669,567 M294R probably benign Het
Zfp788 T G 7: 41,649,075 Y326* probably null Het
Zim1 A G 7: 6,682,125 F109L probably benign Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCAGGACACACAGAGAGATGCTC -3'
(R):5'- TGTAAGCAGCAGCAATCGTGGTAG -3'

Sequencing Primer
(F):5'- AGAGAGATGCTCTCCCAGCTC -3'
(R):5'- CTGTGGCAAACACAGTCTG -3'
Posted On2014-03-28