Incidental Mutation 'R1665:Syt2'
ID187078
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134747620 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 403 (A403D)
Ref Sequence ENSEMBL: ENSMUSP00000140081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000188842]
Predicted Effect probably damaging
Transcript: ENSMUST00000121990
AA Change: A403D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: A403D

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187702
Predicted Effect probably damaging
Transcript: ENSMUST00000188842
AA Change: A403D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: A403D

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Meta Mutation Damage Score 0.804 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CTTTGCTTGCCTTGCAGAAAGTCC -3'
(R):5'- GCCATGTTGTTGGTCCAAAACCC -3'

Sequencing Primer
(F):5'- CCTTGCAGAAAGTCCAGGTG -3'
(R):5'- TAGGGGACTCTCTTCACACAG -3'
Posted On2014-05-09