Incidental Mutation 'R1656:Slc26a7'
ID189084
Institutional Source Beutler Lab
Gene Symbol Slc26a7
Ensembl Gene ENSMUSG00000040569
Gene Namesolute carrier family 26, member 7
Synonyms
MMRRC Submission 039692-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1656 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location14502430-14621805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14621221 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 55 (I55K)
Ref Sequence ENSEMBL: ENSMUSP00000116157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023917] [ENSMUST00000042221] [ENSMUST00000143105] [ENSMUST00000149633]
Predicted Effect probably benign
Transcript: ENSMUST00000023917
SMART Domains Protein: ENSMUSP00000023917
Gene: ENSMUSG00000023151

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000042221
AA Change: I55K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041789
Gene: ENSMUSG00000040569
AA Change: I55K

DomainStartEndE-ValueType
Pfam:Sulfate_transp 47 444 6.9e-95 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Pfam:STAS 493 637 4.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143105
AA Change: I55K

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122870
Gene: ENSMUSG00000040569
AA Change: I55K

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 32 99 7.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149633
AA Change: I55K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116157
Gene: ENSMUSG00000040569
AA Change: I55K

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 32 115 9.9e-28 PFAM
transmembrane domain 145 167 N/A INTRINSIC
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. This gene has abundant and specific expression in the kidney. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice deficient for this marker have a reduce arterial pH and reduced serum bicarbonate. Urine is more concentrated and has an elevated pH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik A T 14: 32,377,944 I42N possibly damaging Het
Adarb2 T A 13: 8,203,251 S11T unknown Het
Adgrg1 C T 8: 95,011,810 Q644* probably null Het
Akr1c18 T G 13: 4,145,253 I69L probably benign Het
Anxa9 C T 3: 95,300,573 V219I probably benign Het
Aqp9 T C 9: 71,138,103 T101A probably benign Het
Arhgef1 C T 7: 24,913,632 R251W probably damaging Het
Arl13b T A 16: 62,806,644 E231D possibly damaging Het
Bcl2l11 C T 2: 128,158,256 A173V probably benign Het
Ccni A T 5: 93,188,074 probably null Het
Cdh18 A G 15: 23,474,399 E785G probably benign Het
Cdk4 A G 10: 127,064,980 Y167C probably benign Het
Clip1 A C 5: 123,630,403 V757G possibly damaging Het
Ctsc T C 7: 88,281,408 V65A possibly damaging Het
Cuedc2 G A 19: 46,331,988 S48L probably damaging Het
Cyp39a1 T A 17: 43,667,619 M4K possibly damaging Het
Dgcr8 T C 16: 18,256,713 S733G probably benign Het
Dnhd1 T C 7: 105,714,281 S4017P probably damaging Het
Ehbp1 A G 11: 22,146,694 I255T probably benign Het
Fam214a C T 9: 75,008,959 A280V probably benign Het
Fam83e T C 7: 45,722,263 V28A probably benign Het
Fanci A G 7: 79,405,188 probably benign Het
Fat1 C T 8: 45,025,530 Q2538* probably null Het
Fshr A G 17: 89,200,581 F11S unknown Het
Gab1 G T 8: 80,788,759 P310Q probably damaging Het
Galnt18 A G 7: 111,616,492 probably benign Het
Gm28042 C A 2: 120,038,889 P355Q probably damaging Het
H2-DMa A G 17: 34,138,142 T205A possibly damaging Het
Hnf4g A T 3: 3,652,951 D420V probably benign Het
Il1b A G 2: 129,366,069 V164A probably damaging Het
Irf4 C A 13: 30,757,502 H279Q probably benign Het
Loxhd1 A G 18: 77,321,668 T203A possibly damaging Het
Lsamp C T 16: 41,955,319 P178S probably damaging Het
Mcm6 T C 1: 128,349,418 S223G possibly damaging Het
Misp G T 10: 79,825,943 V65L possibly damaging Het
Mov10 A G 3: 104,799,596 V666A probably benign Het
Mycbp2 A T 14: 103,247,758 D1102E probably damaging Het
Myef2 G T 2: 125,097,940 probably null Het
Myo1e T A 9: 70,395,934 I1079N probably damaging Het
Nisch G T 14: 31,177,271 probably benign Het
Obox7 T C 7: 14,665,421 S191P probably benign Het
Olfr1137 A T 2: 87,711,078 V276D possibly damaging Het
Olfr293 C T 7: 86,664,123 L154F probably benign Het
Olfr339 G A 2: 36,421,646 V83M probably benign Het
Olfr39 A G 9: 20,286,577 R301G probably damaging Het
Olfr62 A G 4: 118,666,188 I224V probably damaging Het
Olfr746 T C 14: 50,654,008 V257A probably benign Het
Phf1 T C 17: 26,937,359 S492P possibly damaging Het
Phyh A T 2: 4,938,353 N337I probably damaging Het
Poteg A T 8: 27,495,032 probably benign Het
Prag1 G T 8: 36,104,346 K694N probably damaging Het
Proser2 C T 2: 6,103,059 E49K probably damaging Het
Pskh1 T C 8: 105,929,757 V355A possibly damaging Het
Psmc2 T C 5: 21,799,551 V182A possibly damaging Het
Rbfox1 A G 16: 7,306,469 probably benign Het
Slc5a8 G A 10: 88,925,786 probably null Het
Slitrk3 T C 3: 73,050,339 R367G probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata31 A G 13: 64,921,139 E367G probably benign Het
Srrm3 A T 5: 135,835,038 probably null Het
Ssmem1 T C 6: 30,517,508 S6P probably damaging Het
Swap70 A G 7: 110,221,827 D6G probably benign Het
Syt1 T C 10: 108,583,915 E295G probably damaging Het
Tap2 A T 17: 34,205,953 I192F possibly damaging Het
Tgoln1 C T 6: 72,614,085 R348H probably damaging Het
Tln2 C T 9: 67,227,107 V1373I possibly damaging Het
Tmc2 A G 2: 130,247,934 D613G possibly damaging Het
Tmem62 T A 2: 121,007,002 Y597N probably benign Het
Trhr2 T A 8: 122,357,446 T272S probably damaging Het
Ttc30b T C 2: 75,937,416 K331R probably benign Het
Vmn2r92 T C 17: 18,151,936 S3P probably benign Het
Wdfy3 A T 5: 101,941,447 I627N probably damaging Het
Zfhx4 T C 3: 5,413,016 S3564P probably damaging Het
Zfp467 T G 6: 48,439,079 E213A possibly damaging Het
Zfp746 T G 6: 48,064,477 K437N probably damaging Het
Zfp853 A G 5: 143,289,085 probably benign Het
Zranb1 T A 7: 132,949,767 V49D probably benign Het
Other mutations in Slc26a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc26a7 APN 4 14548403 splice site probably benign
IGL00943:Slc26a7 APN 4 14506477 missense probably benign 0.01
IGL01878:Slc26a7 APN 4 14519388 splice site probably null
IGL02698:Slc26a7 APN 4 14593867 missense possibly damaging 0.93
IGL03133:Slc26a7 APN 4 14532576 missense possibly damaging 0.49
R0200:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0608:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0833:Slc26a7 UTSW 4 14593873 missense probably damaging 1.00
R1496:Slc26a7 UTSW 4 14506489 missense probably benign 0.01
R1592:Slc26a7 UTSW 4 14552470 missense probably benign 0.09
R1758:Slc26a7 UTSW 4 14548491 missense possibly damaging 0.58
R1861:Slc26a7 UTSW 4 14522873 missense probably benign
R2429:Slc26a7 UTSW 4 14506399 splice site probably benign
R2850:Slc26a7 UTSW 4 14593806 splice site probably benign
R3442:Slc26a7 UTSW 4 14565511 missense probably benign 0.11
R4158:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4160:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4721:Slc26a7 UTSW 4 14510261 splice site probably null
R4727:Slc26a7 UTSW 4 14590477 missense probably damaging 1.00
R4825:Slc26a7 UTSW 4 14546309 missense probably benign 0.18
R4992:Slc26a7 UTSW 4 14565508 missense probably damaging 1.00
R5024:Slc26a7 UTSW 4 14532572 missense possibly damaging 0.91
R5344:Slc26a7 UTSW 4 14519402 missense probably benign 0.00
R5373:Slc26a7 UTSW 4 14546447 missense probably damaging 0.99
R5540:Slc26a7 UTSW 4 14506621 missense probably benign
R6046:Slc26a7 UTSW 4 14505471 missense probably benign 0.24
R6320:Slc26a7 UTSW 4 14524498 missense probably benign 0.01
R6685:Slc26a7 UTSW 4 14593819 missense probably damaging 1.00
R6685:Slc26a7 UTSW 4 14593820 missense probably damaging 1.00
R6880:Slc26a7 UTSW 4 14516159 missense possibly damaging 0.57
R6958:Slc26a7 UTSW 4 14506442 missense probably benign 0.00
R7000:Slc26a7 UTSW 4 14552476 missense probably benign
R7090:Slc26a7 UTSW 4 14565460 nonsense probably null
R7122:Slc26a7 UTSW 4 14533639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAACTCCTAGCCAGGGGTAG -3'
(R):5'- TGTAAACCACAGACGATTTGGAGCC -3'

Sequencing Primer
(F):5'- AGAAACATCTACTCTGCTTATTTTCC -3'
(R):5'- TTAAGCAGTGGTGTAAGAGGCG -3'
Posted On2014-05-09