Incidental Mutation 'R1688:Klk1b8'
ID189488
Institutional Source Beutler Lab
Gene Symbol Klk1b8
Ensembl Gene ENSMUSG00000063089
Gene Namekallikrein 1-related peptidase b8
SynonymsmGK-8, Klk8, TADG14
MMRRC Submission 039721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1688 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43950664-43954941 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 43945805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072204]
Predicted Effect probably benign
Transcript: ENSMUST00000072204
SMART Domains Protein: ENSMUSP00000072063
Gene: ENSMUSG00000063089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.03e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000078897
SMART Domains Protein: ENSMUSP00000077933
Gene: ENSMUSG00000060161

DomainStartEndE-ValueType
Tryp_SPc 1 92 6.87e0 SMART
low complexity region 98 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206764
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,228,609 V2113A probably benign Het
4930486L24Rik T C 13: 60,854,881 T20A probably benign Het
Acaca T G 11: 84,238,896 V359G probably damaging Het
Adgb G A 10: 10,350,317 R1359* probably null Het
Aggf1 T C 13: 95,364,767 E369G probably damaging Het
Alkbh8 T A 9: 3,382,765 D418E probably damaging Het
Alox8 T C 11: 69,189,906 D203G probably benign Het
Ank A G 15: 27,557,234 D168G probably damaging Het
Ap5m1 A G 14: 49,080,834 probably null Het
Arhgap45 A G 10: 80,029,095 Y964C probably damaging Het
Arhgef2 A G 3: 88,640,300 D571G probably benign Het
Bdh2 A T 3: 135,301,638 Y223F possibly damaging Het
Bin1 T C 18: 32,419,935 probably benign Het
Bin1 G A 18: 32,424,972 probably benign Het
Cacna1g T A 11: 94,425,953 M1514L possibly damaging Het
Cd109 T A 9: 78,705,091 F1253L probably benign Het
Cfap57 T A 4: 118,569,646 E1065V probably null Het
Chmp2b T C 16: 65,551,036 N14S probably benign Het
Crybg1 A T 10: 43,973,798 F1660L probably damaging Het
Cyp2c37 T G 19: 39,994,443 probably null Het
Daam1 A T 12: 71,947,046 I408F unknown Het
Dsc3 T A 18: 19,966,227 D744V probably damaging Het
Eprs T C 1: 185,384,896 F379L probably damaging Het
Ewsr1 G T 11: 5,072,870 D417E unknown Het
Eya4 A T 10: 23,123,861 N424K probably damaging Het
Gm9312 A C 12: 24,251,919 noncoding transcript Het
Havcr2 T C 11: 46,479,364 I206T probably damaging Het
Igfbp2 T C 1: 72,824,966 probably null Het
Ikzf2 T C 1: 69,542,280 K196R possibly damaging Het
Il12rb1 G A 8: 70,819,402 G587R probably damaging Het
Immt A T 6: 71,857,011 H208L probably damaging Het
Kcnq2 C T 2: 181,087,033 V540I probably damaging Het
Mc2r T A 18: 68,408,019 I68F possibly damaging Het
Neil3 T C 8: 53,601,034 E320G probably damaging Het
Nell2 T C 15: 95,431,613 T276A probably damaging Het
Nphp3 T C 9: 104,003,124 L115P probably damaging Het
Nras T C 3: 103,060,373 L95P probably benign Het
Ogt G A X: 101,655,690 V190I probably damaging Het
Olfr1102 A G 2: 87,002,386 Y139C probably benign Het
Olfr745 A T 14: 50,643,248 K322N probably benign Het
P2ry6 T A 7: 100,938,384 H256L probably damaging Het
Pcbp4 T C 9: 106,461,334 S153P probably damaging Het
Pclo T C 5: 14,788,493 probably null Het
Per2 A G 1: 91,423,829 L985P probably damaging Het
Phip T C 9: 82,871,657 N1678S probably benign Het
Pkd1l3 A G 8: 109,623,818 S432G probably benign Het
Plin4 T A 17: 56,109,363 D47V possibly damaging Het
Ppp2cb A G 8: 33,615,452 I163M probably benign Het
Ptpdc1 T C 13: 48,586,224 E577G probably benign Het
Ptprd G T 4: 75,982,684 P1063T probably damaging Het
Ptpru T C 4: 131,787,345 D866G probably benign Het
Rdx T C 9: 52,060,911 probably benign Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rhno1 A G 6: 128,357,934 V142A probably benign Het
Sema5a C T 15: 32,669,424 T698I probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Slc22a3 A T 17: 12,433,807 M350K probably damaging Het
Spata31d1b T A 13: 59,715,460 S141T possibly damaging Het
Tada2a T C 11: 84,084,759 probably null Het
Tmem8 C T 17: 26,118,908 A422V possibly damaging Het
Tspan10 A G 11: 120,442,782 M2V probably damaging Het
Ttll11 T C 2: 35,795,379 T566A probably damaging Het
Vwa8 A G 14: 79,201,103 Q1872R possibly damaging Het
Zfp605 T A 5: 110,129,041 I675N possibly damaging Het
Zkscan8 A T 13: 21,520,154 N538K possibly damaging Het
Other mutations in Klk1b8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Klk1b8 APN 7 43954786 missense probably benign 0.40
IGL01076:Klk1b8 APN 7 43954855 missense probably damaging 1.00
IGL01685:Klk1b8 APN 7 43954870 missense possibly damaging 0.88
IGL01771:Klk1b8 APN 7 43954866 missense probably damaging 0.99
IGL02272:Klk1b8 APN 7 43952793 missense probably damaging 1.00
IGL02596:Klk1b8 APN 7 43952763 missense probably damaging 1.00
R0789:Klk1b8 UTSW 7 43945727 unclassified probably benign
R1005:Klk1b8 UTSW 7 43954334 nonsense probably null
R1628:Klk1b8 UTSW 7 43954141 splice site probably null
R1954:Klk1b8 UTSW 7 43953848 splice site probably benign
R4344:Klk1b8 UTSW 7 43945762 unclassified probably benign
R6294:Klk1b8 UTSW 7 43952772 missense probably damaging 1.00
R6941:Klk1b8 UTSW 7 43952789 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGAACAGAGCTGCCTCTTAGAGTCC -3'
(R):5'- CTTTAGCCAACCGTACACGTACTCC -3'

Sequencing Primer
(F):5'- GCCTCTTAGAGTCCCTGTATTC -3'
(R):5'- GCTGATCTACTTTAGAAGTCCTGAC -3'
Posted On2014-05-14