Incidental Mutation 'R1710:Rrm2b'
ID190486
Institutional Source Beutler Lab
Gene Symbol Rrm2b
Ensembl Gene ENSMUSG00000022292
Gene Nameribonucleotide reductase M2 B (TP53 inducible)
Synonymsp53R2
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37923952-37961318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37929096 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 70 (M70K)
Ref Sequence ENSEMBL: ENSMUSP00000123691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022901] [ENSMUST00000137636] [ENSMUST00000144498] [ENSMUST00000146821] [ENSMUST00000153481]
Predicted Effect probably damaging
Transcript: ENSMUST00000022901
AA Change: M282K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022901
Gene: ENSMUSG00000022292
AA Change: M282K

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 41 308 4.2e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137636
AA Change: M230K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119400
Gene: ENSMUSG00000022292
AA Change: M230K

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 6 261 1.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144498
SMART Domains Protein: ENSMUSP00000121069
Gene: ENSMUSG00000022292

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 32 111 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146821
AA Change: M70K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123691
Gene: ENSMUSG00000022292
AA Change: M70K

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 13 101 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153481
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Loss of both functional copies of this gene results in growth retardation, multiple organ failure, and ultimately premature death due to kidney failure. Spontaneous mutation rates and apoptosis are increased in the kidneys due to an attenuation of dNTP pools and a resulting impairment of DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp142 T A 1: 74,572,230 D601V probably damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Rrm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Rrm2b APN 15 37929075 missense probably damaging 1.00
IGL00806:Rrm2b APN 15 37931622 missense probably benign 0.02
IGL01145:Rrm2b APN 15 37944560 missense probably damaging 0.96
R0026:Rrm2b UTSW 15 37953741 missense probably benign 0.19
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0624:Rrm2b UTSW 15 37931645 missense probably benign 0.00
R1371:Rrm2b UTSW 15 37946809 missense probably benign 0.06
R1635:Rrm2b UTSW 15 37945084 missense probably damaging 1.00
R1692:Rrm2b UTSW 15 37927322 nonsense probably null
R2273:Rrm2b UTSW 15 37945051 missense possibly damaging 0.92
R3196:Rrm2b UTSW 15 37945147 unclassified probably null
R4459:Rrm2b UTSW 15 37945153 splice site probably null
R5310:Rrm2b UTSW 15 37927327 missense probably damaging 1.00
R5747:Rrm2b UTSW 15 37927390 missense probably benign
Predicted Primers PCR Primer
(F):5'- tggcagactccaacaCTTTCAGTAAAAT -3'
(R):5'- TTCTGGCATACCTTGCCTTGAGTAAAAT -3'

Sequencing Primer
(F):5'- ttgaatgagaatagaccccagag -3'
(R):5'- gagttgggatggggaaaagg -3'
Posted On2014-05-14