Incidental Mutation 'R1791:Olfr623'
ID201727
Institutional Source Beutler Lab
Gene Symbol Olfr623
Ensembl Gene ENSMUSG00000099687
Gene Nameolfactory receptor 623
SynonymsMOR1-4, GA_x6K02T2PBJ9-6384836-6383883
MMRRC Submission 039821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1791 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103657697-103663698 bp(-) (GRCm38)
Type of Mutationunclassified (4663 bp from exon)
DNA Base Change (assembly) T to C at 103660798 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144] [ENSMUST00000068531] [ENSMUST00000213840]
Predicted Effect probably null
Transcript: ENSMUST00000062144
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068531
AA Change: M151V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: M151V

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1.7e-112 PFAM
Pfam:7TM_GPCR_Srsx 36 299 3.1e-7 PFAM
Pfam:7tm_1 42 293 2.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213840
AA Change: M151V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.5972 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Akap13 T G 7: 75,611,035 C333G probably benign Het
Akap6 T C 12: 53,069,125 S1004P probably damaging Het
Akap7 T C 10: 25,239,685 T181A probably benign Het
Ap3b1 A G 13: 94,408,797 E186G possibly damaging Het
Arhgap17 T C 7: 123,286,702 T736A probably benign Het
Bmp8a G T 4: 123,324,585 R214S possibly damaging Het
Cacna1f T C X: 7,620,439 S890P probably damaging Het
Cd96 A T 16: 46,117,999 Y34* probably null Het
Cdc42ep4 A G 11: 113,729,337 L76P probably damaging Het
Cdh23 A G 10: 60,391,726 V1195A possibly damaging Het
Cfap57 G A 4: 118,571,724 T1015M possibly damaging Het
Chrm3 C A 13: 9,877,416 G528V probably damaging Het
Clip4 T C 17: 71,801,942 probably benign Het
Col9a1 A T 1: 24,185,305 R189S unknown Het
Cul4b A T X: 38,547,851 I481N probably damaging Het
Cyp26b1 A G 6: 84,584,459 S74P probably benign Het
Cyp3a57 A G 5: 145,371,010 N192S probably benign Het
Dcbld1 A G 10: 52,319,476 D260G probably damaging Het
Dhrs7 T C 12: 72,653,165 N231S probably benign Het
Disp3 G A 4: 148,241,518 P1261L probably damaging Het
Dyx1c1 T C 9: 72,960,684 Y76H possibly damaging Het
Eml5 C A 12: 98,887,056 V95F probably benign Het
Emsy A G 7: 98,647,880 I32T probably damaging Het
Esr1 A G 10: 4,783,913 R238G probably damaging Het
Exosc1 T C 19: 41,928,085 K84R probably benign Het
F830016B08Rik T A 18: 60,300,517 V224E probably benign Het
Fam228a T A 12: 4,732,748 N115I probably damaging Het
Farp1 T C 14: 121,256,745 I546T probably damaging Het
Fbxo30 T A 10: 11,289,787 C84* probably null Het
Fbxw17 A G 13: 50,425,774 probably benign Het
Foxo4 G C X: 101,258,463 R192P probably benign Het
Galnt7 G T 8: 57,542,530 T377K probably benign Het
Garnl3 T C 2: 33,034,127 I248V probably benign Het
Glod4 A G 11: 76,237,708 Y104H probably damaging Het
Glrb T C 3: 80,860,175 Y246C probably damaging Het
Gm5292 A G 5: 43,944,410 noncoding transcript Het
Gm5424 C A 10: 62,072,307 noncoding transcript Het
Gm7276 C T 18: 77,185,735 probably benign Het
Gm9774 T A 3: 92,428,231 D388V probably damaging Het
Golga5 A G 12: 102,492,131 N611S possibly damaging Het
Gucy2c A C 6: 136,744,027 Y391D probably damaging Het
H6pd A G 4: 149,981,673 I760T probably damaging Het
Hapln2 T A 3: 88,024,405 I5F possibly damaging Het
Hdac11 G T 6: 91,168,824 V169L probably benign Het
Hectd2 T C 19: 36,609,416 V557A possibly damaging Het
Huwe1 T A X: 151,864,753 N747K probably benign Het
Ints1 A G 5: 139,774,522 S66P probably benign Het
Ipo7 A G 7: 110,027,132 D49G probably damaging Het
Itgb4 G A 11: 115,988,520 C575Y probably damaging Het
Klhl3 A G 13: 58,033,230 V250A possibly damaging Het
Klk1b24 A G 7: 44,190,428 probably null Het
Map3k11 T A 19: 5,695,572 Y333* probably null Het
Mbp A G 18: 82,554,349 T57A probably benign Het
Myh9 A G 15: 77,773,264 probably benign Het
Mypn C T 10: 63,125,693 R1040Q probably damaging Het
Ncdn A G 4: 126,751,939 probably null Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Odf3l1 A T 9: 56,851,743 F43I possibly damaging Het
Olfr509 T A 7: 108,646,364 T71S probably benign Het
Olfr566 G A 7: 102,856,362 Q307* probably null Het
Olfr726 A G 14: 50,084,042 F213S probably benign Het
Olfr749 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,736,687 probably benign Het
Olfr924 T A 9: 38,848,605 S164T possibly damaging Het
Pbx3 T C 2: 34,224,452 T82A possibly damaging Het
Pi15 T C 1: 17,602,721 F48S probably benign Het
Pkhd1 A G 1: 20,585,152 probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Prrc2c G T 1: 162,704,982 probably benign Het
Prune1 A G 3: 95,268,242 Y41H possibly damaging Het
Rcsd1 T C 1: 165,655,972 D150G probably damaging Het
Rgs12 A T 5: 34,966,112 Q413L possibly damaging Het
Rhox2h A G X: 37,669,195 Y185H probably damaging Het
Rnf17 T A 14: 56,504,007 C1306* probably null Het
Ros1 T A 10: 52,100,087 M1499L probably benign Het
Rubcnl T C 14: 75,047,549 S503P probably damaging Het
Sap18b A T 8: 95,825,714 R117S probably benign Het
Shank2 A G 7: 144,410,599 E858G probably damaging Het
Shtn1 T C 19: 59,032,200 R197G probably damaging Het
Slamf8 G A 1: 172,584,520 R163* probably null Het
Slc6a3 T C 13: 73,566,292 I392T possibly damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Sp8 T C 12: 118,849,016 V202A possibly damaging Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Stpg2 A T 3: 139,317,401 T393S probably benign Het
Tagap T C 17: 7,931,467 M228T probably damaging Het
Tagap A G 17: 7,933,545 T521A probably benign Het
Tas2r123 T G 6: 132,847,565 S142A probably damaging Het
Tat T A 8: 109,991,629 S49T probably benign Het
Tfap4 G T 16: 4,552,069 Q41K possibly damaging Het
Thbs2 T C 17: 14,685,813 N275S probably benign Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tnrc6a T C 7: 123,192,917 V1886A possibly damaging Het
Trim56 G A 5: 137,114,398 A88V probably damaging Het
Trio A G 15: 27,841,756 Y1081H probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ube2o G A 11: 116,541,494 T882I probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Upk3a A G 15: 85,020,614 T188A possibly damaging Het
Vmn1r79 A C 7: 12,176,431 D80A probably damaging Het
Wls C A 3: 159,911,813 T375K probably benign Het
Wnt5a T C 14: 28,511,878 M1T probably null Het
Zcchc4 A G 5: 52,796,590 E204G probably damaging Het
Zfp513 G A 5: 31,200,334 P232S possibly damaging Het
Other mutations in Olfr623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr623 APN 7 103661067 missense probably damaging 0.99
IGL01669:Olfr623 APN 7 103660987 missense probably benign 0.02
IGL01731:Olfr623 APN 7 103660846 missense probably benign 0.01
IGL02057:Olfr623 APN 7 103660653 missense probably damaging 1.00
IGL02249:Olfr623 APN 7 103660366 missense probably damaging 0.99
IGL02937:Olfr623 APN 7 103660905 missense probably damaging 1.00
IGL03113:Olfr623 APN 7 103660644 missense possibly damaging 0.90
R0413:Olfr623 UTSW 7 103660750 missense possibly damaging 0.52
R0862:Olfr623 UTSW 7 103660528 missense probably damaging 1.00
R1262:Olfr623 UTSW 7 103660441 missense probably benign 0.33
R2327:Olfr623 UTSW 7 103660572 missense probably damaging 1.00
R2338:Olfr623 UTSW 7 103660410 missense possibly damaging 0.90
R4521:Olfr623 UTSW 7 103660332 missense probably benign 0.01
R4831:Olfr623 UTSW 7 103660471 missense probably benign 0.40
R5322:Olfr623 UTSW 7 103660672 missense possibly damaging 0.62
R6270:Olfr623 UTSW 7 103660413 missense possibly damaging 0.48
R6959:Olfr623 UTSW 7 103660843 missense probably damaging 1.00
R7157:Olfr623 UTSW 7 103660581 missense probably damaging 1.00
R7181:Olfr623 UTSW 7 103660813 missense probably damaging 0.99
X0066:Olfr623 UTSW 7 103660660 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGCCCATGACAGTCTTGAG -3'
(R):5'- ATGGAGCCTGCTTCTCTCAG -3'

Sequencing Primer
(F):5'- CCATGACAGTCTTGAGAATCAAAATG -3'
(R):5'- TCTCTCAGGCCTATTTTATCCATAG -3'
Posted On2014-06-23