Incidental Mutation 'R1803:Cd44'
ID203257
Institutional Source Beutler Lab
Gene Symbol Cd44
Ensembl Gene ENSMUSG00000005087
Gene NameCD44 antigen
SynonymsPgp-1, HERMES, Ly-24
MMRRC Submission 039833-MU
Accession Numbers

Genbank: NM_009851; MGI: 88338

Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location102811141-102901665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102834252 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 332 (P332S)
Ref Sequence ENSEMBL: ENSMUSP00000106825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005218] [ENSMUST00000060516] [ENSMUST00000099673] [ENSMUST00000111190] [ENSMUST00000111191] [ENSMUST00000111192] [ENSMUST00000111194] [ENSMUST00000111198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005218
AA Change: P535S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005218
Gene: ENSMUSG00000005087
AA Change: P535S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 251 276 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
PDB:2ZPY|B 710 729 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000060516
AA Change: P335S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062330
Gene: ENSMUSG00000005087
AA Change: P335S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 229 239 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
PDB:2ZPY|B 510 529 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099673
SMART Domains Protein: ENSMUSP00000097265
Gene: ENSMUSG00000005087

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 225 238 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
PDB:2ZPY|B 295 314 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111190
SMART Domains Protein: ENSMUSP00000106821
Gene: ENSMUSG00000005087

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 324 337 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
PDB:2ZPY|B 394 413 8e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111191
AA Change: P253S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106822
Gene: ENSMUSG00000005087
AA Change: P253S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
PDB:2ZPY|B 428 447 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111192
SMART Domains Protein: ENSMUSP00000106823
Gene: ENSMUSG00000005087

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 294 307 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
PDB:2ZPY|B 364 383 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111194
AA Change: P332S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106825
Gene: ENSMUSG00000005087
AA Change: P332S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
PDB:2ZPY|B 507 526 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111198
AA Change: P412S

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106829
Gene: ENSMUSG00000005087
AA Change: P412S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LINK 34 125 5.88e-38 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
PDB:2ZPY|B 587 606 1e-6 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(4) Targeted, other(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Cd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Cd44 APN 2 102855947 missense possibly damaging 0.73
IGL01087:Cd44 APN 2 102822262 missense probably damaging 1.00
IGL01413:Cd44 APN 2 102814287 missense probably damaging 0.99
IGL01830:Cd44 APN 2 102842258 splice site probably benign
IGL02221:Cd44 APN 2 102846513 missense probably benign 0.01
IGL02271:Cd44 APN 2 102831387 missense possibly damaging 0.93
IGL02552:Cd44 APN 2 102848731 missense probably benign 0.01
IGL02861:Cd44 APN 2 102832481 critical splice donor site probably null
IGL03309:Cd44 APN 2 102814177 missense probably damaging 1.00
IGL03352:Cd44 APN 2 102845414 intron probably benign
Jialin UTSW 2 102865370 missense probably damaging 0.99
Kale UTSW 2 102824303 missense probably damaging 0.99
N/A - 535:Cd44 UTSW 2 102814189 missense possibly damaging 0.50
R0488:Cd44 UTSW 2 102834219 splice site probably benign
R1441:Cd44 UTSW 2 102846418 missense probably damaging 0.99
R1482:Cd44 UTSW 2 102831383 missense probably damaging 1.00
R1497:Cd44 UTSW 2 102842955 splice site probably null
R1952:Cd44 UTSW 2 102853087 missense probably damaging 0.98
R2093:Cd44 UTSW 2 102814284 missense probably damaging 1.00
R2180:Cd44 UTSW 2 102828610 missense possibly damaging 0.66
R2425:Cd44 UTSW 2 102861586 missense probably damaging 1.00
R3687:Cd44 UTSW 2 102901350 utr 5 prime probably null
R3820:Cd44 UTSW 2 102901393 unclassified probably null
R3821:Cd44 UTSW 2 102901393 unclassified probably null
R3822:Cd44 UTSW 2 102901393 unclassified probably null
R4060:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R4633:Cd44 UTSW 2 102853047 missense possibly damaging 0.86
R4647:Cd44 UTSW 2 102837929 missense possibly damaging 0.68
R4780:Cd44 UTSW 2 102861565 missense probably damaging 1.00
R5087:Cd44 UTSW 2 102831354 missense possibly damaging 0.83
R5118:Cd44 UTSW 2 102865370 missense probably damaging 0.99
R5449:Cd44 UTSW 2 102832546 missense probably damaging 1.00
R5642:Cd44 UTSW 2 102901342 missense probably damaging 1.00
R5928:Cd44 UTSW 2 102824303 missense probably damaging 0.99
R5995:Cd44 UTSW 2 102861670 missense probably damaging 1.00
R5999:Cd44 UTSW 2 102845397 missense probably benign 0.42
R7050:Cd44 UTSW 2 102814137 missense probably damaging 0.99
R7350:Cd44 UTSW 2 102834262 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTACAAGAAAGGCCGACAATG -3'
(R):5'- TATCCCAATTCTGGACATGTGTAC -3'

Sequencing Primer
(F):5'- GAAAACAGATTCAGACCCTGGCTG -3'
(R):5'- CCAATTCTGGACATGTGTACCAATTC -3'
Posted On2014-06-23