Incidental Mutation 'R1861:Fgfr3'
ID203898
Institutional Source Beutler Lab
Gene Symbol Fgfr3
Ensembl Gene ENSMUSG00000054252
Gene Namefibroblast growth factor receptor 3
Synonymssam3, Fgfr-3, HBGFR
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1861 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33721674-33737068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33729746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 165 (T165A)
Ref Sequence ENSEMBL: ENSMUSP00000144379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067150] [ENSMUST00000087820] [ENSMUST00000114411] [ENSMUST00000155002] [ENSMUST00000164207] [ENSMUST00000169212] [ENSMUST00000171509] [ENSMUST00000201295] [ENSMUST00000201437] [ENSMUST00000202138]
Predicted Effect probably damaging
Transcript: ENSMUST00000067150
AA Change: T165A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070998
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087820
AA Change: T147A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085122
Gene: ENSMUSG00000054252
AA Change: T147A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114411
AA Change: T165A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110053
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152661
Predicted Effect probably damaging
Transcript: ENSMUST00000155002
AA Change: T13A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000164207
AA Change: T165A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133064
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 467 743 3.14e-153 SMART
low complexity region 766 782 N/A INTRINSIC
low complexity region 790 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169212
AA Change: T165A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130856
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171509
AA Change: T165A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131845
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000181298
AA Change: T3A
Predicted Effect probably benign
Transcript: ENSMUST00000201295
SMART Domains Protein: ENSMUSP00000144104
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
IG 11 71 1.9e-3 SMART
transmembrane domain 90 112 N/A INTRINSIC
PDB:2PSQ|B 126 223 2e-30 PDB
Blast:IG_like 140 223 2e-51 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000201437
AA Change: T165A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144379
Gene: ENSMUSG00000054252
AA Change: T165A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 2e-6 SMART
Pfam:Ig_3 144 194 2.1e-3 PFAM
Pfam:I-set 153 194 9.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202138
AA Change: T147A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143945
Gene: ENSMUSG00000054252
AA Change: T147A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202182
AA Change: T153A
Predicted Effect probably benign
Transcript: ENSMUST00000202791
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: This gene encodes a member of the fibroblast growth factor receptor family. Members of this family are highly conserved proteins that differ from one another in their ligand affinities and tissue distribution. A representative protein consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene may be associated with craniosynostosis and multiple types of skeletal dysplasia. A pseudogene of this gene is located on chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mutant alleles generally cause skeletal deformities, with some causing decreased body size, premature death, or hearing loss due to developmental defects of the ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Clcn1 C A 6: 42,313,991 P933Q possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dnaic2 T C 11: 114,752,951 V481A possibly damaging Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kcnh7 A G 2: 62,777,392 V615A probably damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Mark2 T C 19: 7,290,763 D25G possibly damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pif1 A T 9: 65,589,453 I283F probably damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Fgfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Fgfr3 APN 5 33735140 missense possibly damaging 0.57
IGL01585:Fgfr3 APN 5 33733961 missense probably damaging 0.96
IGL03266:Fgfr3 APN 5 33734365 missense probably damaging 1.00
IGL03285:Fgfr3 APN 5 33735213 missense probably damaging 1.00
R0543:Fgfr3 UTSW 5 33729710 start codon destroyed probably null 0.00
R0604:Fgfr3 UTSW 5 33732782 missense probably damaging 0.99
R1496:Fgfr3 UTSW 5 33729750 missense probably damaging 0.96
R2919:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R2920:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R4361:Fgfr3 UTSW 5 33723332 intron probably benign
R4506:Fgfr3 UTSW 5 33729999 missense probably damaging 1.00
R4513:Fgfr3 UTSW 5 33723116 intron probably benign
R4647:Fgfr3 UTSW 5 33734986 unclassified probably benign
R5240:Fgfr3 UTSW 5 33730038 missense probably damaging 1.00
R5251:Fgfr3 UTSW 5 33735556 unclassified probably benign
R5454:Fgfr3 UTSW 5 33723298 intron probably benign
R5595:Fgfr3 UTSW 5 33730003 missense probably damaging 1.00
R5984:Fgfr3 UTSW 5 33729705 missense probably damaging 1.00
R6753:Fgfr3 UTSW 5 33732159 missense probably benign 0.35
R6985:Fgfr3 UTSW 5 33735441 missense probably null 1.00
R7106:Fgfr3 UTSW 5 33731414 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGGCAAAGCAAAGGACTC -3'
(R):5'- GGTACCACACTTTCCATGACC -3'

Sequencing Primer
(F):5'- AGCAAAGGACTCTGAATCCAG -3'
(R):5'- ATGACCAAGCTCCACTGCTGG -3'
Posted On2014-06-23