Incidental Mutation 'R1861:Mark2'
ID203973
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R1861 (G1)
Quality Score108
Status Not validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7290763 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000129924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000165989] [ENSMUST00000168324] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171393]
Predicted Effect probably benign
Transcript: ENSMUST00000025921
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032557
AA Change: D25G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051711
AA Change: D25G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164205
AA Change: D25G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165286
AA Change: D25G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165965
AA Change: D25G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165989
AA Change: D25G

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129924
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
Pfam:Pkinase 53 89 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably benign
Transcript: ENSMUST00000168872
AA Change: D25G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
AA Change: D25G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969
AA Change: D25G

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: D15G
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: D15G

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Clcn1 C A 6: 42,313,991 P933Q possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dnaic2 T C 11: 114,752,951 V481A possibly damaging Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fgfr3 A G 5: 33,729,746 T165A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kcnh7 A G 2: 62,777,392 V615A probably damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pif1 A T 9: 65,589,453 I283F probably damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1873:Mark2 UTSW 19 7284515 missense probably damaging 1.00
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2162:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2844:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
R7032:Mark2 UTSW 19 7287333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCTAGGAGCTGCTAC -3'
(R):5'- AGTGAAAACTGGCTGTGATGC -3'

Sequencing Primer
(F):5'- TAGGAGCTGCTACCATGGC -3'
(R):5'- GCTGTGATGCCTTCCCTTC -3'
Posted On2014-06-23