Incidental Mutation 'R1818:Gm4847'
ID204562
Institutional Source Beutler Lab
Gene Symbol Gm4847
Ensembl Gene ENSMUSG00000051081
Gene Namepredicted gene 4847
Synonyms
MMRRC Submission 039846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1818 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location166628971-166647693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166638219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 267 (H267L)
Ref Sequence ENSEMBL: ENSMUSP00000039839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046662]
Predicted Effect probably damaging
Transcript: ENSMUST00000046662
AA Change: H267L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039839
Gene: ENSMUSG00000051081
AA Change: H267L

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 1.4e-235 PFAM
Pfam:Pyr_redox_2 4 241 5.2e-11 PFAM
Pfam:Pyr_redox_3 7 221 6.7e-15 PFAM
Pfam:NAD_binding_8 8 92 1.6e-7 PFAM
Pfam:K_oxygenase 77 333 5.2e-9 PFAM
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.5%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,858 probably null Het
Adam6b T A 12: 113,491,256 N564K probably benign Het
Ahi1 A G 10: 20,988,562 Y731C probably damaging Het
Ankk1 A G 9: 49,420,425 Y190H probably benign Het
Ankmy1 T A 1: 92,886,831 D318V probably benign Het
Ankrd33b G A 15: 31,367,121 A91V probably damaging Het
Ap3b1 A G 13: 94,471,704 N561S possibly damaging Het
Apob A G 12: 8,006,834 N1739S probably damaging Het
Apob A G 12: 8,013,064 T236A possibly damaging Het
Birc6 G A 17: 74,649,849 A3593T probably damaging Het
Bnc2 A G 4: 84,291,874 F778L possibly damaging Het
Capn2 T A 1: 182,472,597 K609N probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccl20 A G 1: 83,117,808 Y30C probably damaging Het
Cd209a G A 8: 3,745,576 T106I probably damaging Het
Cebpz A G 17: 78,935,376 L283P probably damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Clec4e T A 6: 123,285,493 D155V possibly damaging Het
Col25a1 G A 3: 130,585,737 probably null Het
Cyp2j11 A T 4: 96,297,739 V403D probably damaging Het
Cyp4v3 G A 8: 45,315,636 R296C possibly damaging Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Denr T A 5: 123,917,220 D49E probably benign Het
Dnaaf3 A T 7: 4,523,569 probably null Het
Dnaaf3 G T 7: 4,523,570 L503M probably benign Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Ehd4 C T 2: 120,102,404 W180* probably null Het
Ephb2 A G 4: 136,655,336 S984P probably benign Het
Eva1a T C 6: 82,071,144 M1T probably null Het
Fam90a1a C G 8: 21,963,771 P381A possibly damaging Het
Fam90a1a C A 8: 21,963,772 P381Q probably damaging Het
Flnc T C 6: 29,457,448 Y2382H probably damaging Het
Flrt1 A T 19: 7,095,346 L612Q probably damaging Het
Fubp1 T A 3: 152,222,169 N419K probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm11639 T A 11: 104,721,507 L652Q probably benign Het
Golga4 T G 9: 118,572,987 V91G probably damaging Het
Hip1r T C 5: 123,995,955 probably null Het
Ice2 A G 9: 69,432,101 S967G probably benign Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Impdh2 T G 9: 108,563,212 probably null Het
Inmt C A 6: 55,173,419 V78F possibly damaging Het
Inpp5e T C 2: 26,397,874 S637G probably benign Het
Kansl1 T C 11: 104,342,457 H748R possibly damaging Het
Kif28 T C 1: 179,705,754 K541E possibly damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Kifc2 T C 15: 76,666,081 V480A probably damaging Het
Lrrc74a T C 12: 86,737,710 Y71H probably damaging Het
Ly75 T G 2: 60,311,777 T1330P probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mgat1 T C 11: 49,261,284 I198T possibly damaging Het
Morc3 A G 16: 93,855,510 Y367C probably damaging Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Mtfr1 A G 3: 19,215,673 T162A probably damaging Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nup153 A T 13: 46,681,637 N1397K possibly damaging Het
Olfr196 T C 16: 59,167,880 K88E probably benign Het
Olfr883 T C 9: 38,026,507 S234P probably damaging Het
Olfr935 T C 9: 38,994,606 I276M possibly damaging Het
Olfr986 T C 9: 40,187,262 V49A probably benign Het
Pabpc2 G T 18: 39,774,110 V143L probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Patj G A 4: 98,623,648 V144M possibly damaging Het
Pde1c T A 6: 56,126,892 K651* probably null Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdha2 T A 3: 141,211,199 K183* probably null Het
Pkd1l3 T A 8: 109,648,406 C1504S probably benign Het
Plbd2 A T 5: 120,487,509 probably null Het
Poteg G A 8: 27,450,167 W121* probably null Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Ptprf A G 4: 118,209,871 Y1883H probably damaging Het
Puf60 T C 15: 76,071,474 T322A possibly damaging Het
Rev3l A G 10: 39,828,424 I281M probably benign Het
Rufy1 T C 11: 50,414,572 I305V probably benign Het
Shisa9 A C 16: 12,267,562 Q329P probably damaging Het
Siglech G A 7: 55,768,584 R100Q probably damaging Het
Slc13a5 T A 11: 72,253,343 Y303F probably benign Het
Snx6 C T 12: 54,783,474 V67I possibly damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Tecpr2 A G 12: 110,926,454 Y310C probably damaging Het
Top1 T A 2: 160,715,723 L575Q probably damaging Het
Usp16 C T 16: 87,479,132 R452* probably null Het
Utrn A G 10: 12,709,964 probably null Het
Vps13b G A 15: 35,877,577 G2899E probably benign Het
Wdr78 A G 4: 103,072,657 V56A possibly damaging Het
Wipi2 T A 5: 142,658,208 L115Q probably damaging Het
Zbtb7c A C 18: 76,137,525 E228A probably damaging Het
Zfp26 T C 9: 20,442,191 T101A probably benign Het
Zfp593 A T 4: 134,245,083 probably null Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfp948 G A 17: 21,584,807 V20M probably damaging Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Gm4847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Gm4847 APN 1 166630392 missense possibly damaging 0.55
IGL00943:Gm4847 APN 1 166642353 missense probably benign 0.01
IGL00948:Gm4847 APN 1 166630338 missense probably benign 0.01
IGL01146:Gm4847 APN 1 166634952 missense probably damaging 1.00
IGL01345:Gm4847 APN 1 166634972 missense probably damaging 1.00
IGL01654:Gm4847 APN 1 166638348 missense probably damaging 1.00
IGL01817:Gm4847 APN 1 166634902 missense probably damaging 1.00
IGL02028:Gm4847 APN 1 166642196 missense probably benign 0.23
IGL02031:Gm4847 APN 1 166635009 missense probably damaging 1.00
IGL02412:Gm4847 APN 1 166641738 missense probably damaging 0.98
IGL03278:Gm4847 APN 1 166635036 missense probably benign 0.06
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0121:Gm4847 UTSW 1 166642288 missense probably damaging 1.00
R0492:Gm4847 UTSW 1 166630392 missense probably damaging 1.00
R0973:Gm4847 UTSW 1 166630255 missense probably benign 0.07
R1136:Gm4847 UTSW 1 166630366 missense probably damaging 0.98
R1522:Gm4847 UTSW 1 166641650 missense probably damaging 1.00
R1730:Gm4847 UTSW 1 166638339 missense possibly damaging 0.80
R1819:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R2145:Gm4847 UTSW 1 166634903 missense probably benign 0.00
R4628:Gm4847 UTSW 1 166630395 missense probably damaging 1.00
R4850:Gm4847 UTSW 1 166642339 missense probably damaging 1.00
R5065:Gm4847 UTSW 1 166634790 missense probably damaging 0.99
R5068:Gm4847 UTSW 1 166638384 missense possibly damaging 0.81
R5493:Gm4847 UTSW 1 166630321 missense probably damaging 1.00
R5500:Gm4847 UTSW 1 166635042 missense probably damaging 1.00
R5990:Gm4847 UTSW 1 166643373 missense probably benign 0.00
R6018:Gm4847 UTSW 1 166643448 missense probably damaging 1.00
R6178:Gm4847 UTSW 1 166642336 missense probably damaging 1.00
R6190:Gm4847 UTSW 1 166630323 missense probably damaging 0.98
R6220:Gm4847 UTSW 1 166634972 missense probably damaging 1.00
R6654:Gm4847 UTSW 1 166630387 missense probably damaging 1.00
X0018:Gm4847 UTSW 1 166634950 missense probably benign 0.24
X0024:Gm4847 UTSW 1 166632715 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTGGGATCACAAAGAACCTTCAG -3'
(R):5'- AACCCCTCCTCTCTTGAAGG -3'

Sequencing Primer
(F):5'- CACGCACCTATAGCTTAC -3'
(R):5'- GGTTTTCCTCAGCACAAGACAAGG -3'
Posted On2014-06-23