Incidental Mutation 'R5500:Gm4847'
ID430549
Institutional Source Beutler Lab
Gene Symbol Gm4847
Ensembl Gene ENSMUSG00000051081
Gene Namepredicted gene 4847
Synonyms
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location166628971-166647693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166635042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 293 (I293T)
Ref Sequence ENSEMBL: ENSMUSP00000039839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046662]
Predicted Effect probably damaging
Transcript: ENSMUST00000046662
AA Change: I293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039839
Gene: ENSMUSG00000051081
AA Change: I293T

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 1.4e-235 PFAM
Pfam:Pyr_redox_2 4 241 5.2e-11 PFAM
Pfam:Pyr_redox_3 7 221 6.7e-15 PFAM
Pfam:NAD_binding_8 8 92 1.6e-7 PFAM
Pfam:K_oxygenase 77 333 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Gm4847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Gm4847 APN 1 166630392 missense possibly damaging 0.55
IGL00943:Gm4847 APN 1 166642353 missense probably benign 0.01
IGL00948:Gm4847 APN 1 166630338 missense probably benign 0.01
IGL01146:Gm4847 APN 1 166634952 missense probably damaging 1.00
IGL01345:Gm4847 APN 1 166634972 missense probably damaging 1.00
IGL01654:Gm4847 APN 1 166638348 missense probably damaging 1.00
IGL01817:Gm4847 APN 1 166634902 missense probably damaging 1.00
IGL02028:Gm4847 APN 1 166642196 missense probably benign 0.23
IGL02031:Gm4847 APN 1 166635009 missense probably damaging 1.00
IGL02412:Gm4847 APN 1 166641738 missense probably damaging 0.98
IGL03278:Gm4847 APN 1 166635036 missense probably benign 0.06
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0121:Gm4847 UTSW 1 166642288 missense probably damaging 1.00
R0492:Gm4847 UTSW 1 166630392 missense probably damaging 1.00
R0973:Gm4847 UTSW 1 166630255 missense probably benign 0.07
R1136:Gm4847 UTSW 1 166630366 missense probably damaging 0.98
R1522:Gm4847 UTSW 1 166641650 missense probably damaging 1.00
R1730:Gm4847 UTSW 1 166638339 missense possibly damaging 0.80
R1818:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R1819:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R2145:Gm4847 UTSW 1 166634903 missense probably benign 0.00
R4628:Gm4847 UTSW 1 166630395 missense probably damaging 1.00
R4850:Gm4847 UTSW 1 166642339 missense probably damaging 1.00
R5065:Gm4847 UTSW 1 166634790 missense probably damaging 0.99
R5068:Gm4847 UTSW 1 166638384 missense possibly damaging 0.81
R5493:Gm4847 UTSW 1 166630321 missense probably damaging 1.00
R5990:Gm4847 UTSW 1 166643373 missense probably benign 0.00
R6018:Gm4847 UTSW 1 166643448 missense probably damaging 1.00
R6178:Gm4847 UTSW 1 166642336 missense probably damaging 1.00
R6190:Gm4847 UTSW 1 166630323 missense probably damaging 0.98
R6220:Gm4847 UTSW 1 166634972 missense probably damaging 1.00
R6654:Gm4847 UTSW 1 166630387 missense probably damaging 1.00
X0018:Gm4847 UTSW 1 166634950 missense probably benign 0.24
X0024:Gm4847 UTSW 1 166632715 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTGGTTGTCTAGGACTCCTG -3'
(R):5'- AAAATGTTCCATGGCTTGTCC -3'

Sequencing Primer
(F):5'- CAAAGATGGCCGATGTTG -3'
(R):5'- CCATGGTTTCTCTATGGGTATGAGAC -3'
Posted On2016-10-05