Incidental Mutation 'R0127:Spag4'
ID21430
Institutional Source Beutler Lab
Gene Symbol Spag4
Ensembl Gene ENSMUSG00000038180
Gene Namesperm associated antigen 4
Synonyms1700041K21Rik, Sun4
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R0127 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location156065175-156070617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156068042 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 302 (V302A)
Ref Sequence ENSEMBL: ENSMUSP00000036484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000132494] [ENSMUST00000137966] [ENSMUST00000138178] [ENSMUST00000184265]
Predicted Effect probably damaging
Transcript: ENSMUST00000038860
AA Change: V302A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180
AA Change: V302A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125996
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131144
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136765
Predicted Effect probably damaging
Transcript: ENSMUST00000137966
AA Change: V208A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118715
Gene: ENSMUSG00000038180
AA Change: V208A

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149139
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian sperm flagellum contains two cytoskeletal structures associated with the axoneme: the outer dense fibers surrounding the axoneme in the midpiece and principal piece and the fibrous sheath surrounding the outer dense fibers in the principal piece of the tail. Defects in these structures are associated with abnormal tail morphology, reduced sperm motility, and infertility. In the rat, the protein encoded by this gene associates with an outer dense fiber protein via a leucine zipper motif and localizes to the microtubules of the manchette and axoneme during sperm tail development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show disrupted spermiogenesis, severe defects in sperm head formation, abnormal manchette morphology, globozoospermia, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dlx4 T G 11: 95,141,229 M240L probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Mkrn1 A G 6: 39,399,275 W466R probably benign Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc12a1 A G 2: 125,219,762 R958G probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spire2 A C 8: 123,358,097 probably benign Het
Sptbn2 G T 19: 4,724,744 V142L probably damaging Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Trim12c A G 7: 104,340,906 probably null Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Spag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Spag4 APN 2 156069332 missense possibly damaging 0.88
IGL01843:Spag4 APN 2 156068497 missense probably benign 0.04
IGL02200:Spag4 APN 2 156066597 missense probably benign 0.14
IGL02506:Spag4 APN 2 156069222 missense probably damaging 1.00
IGL02570:Spag4 APN 2 156068444 missense possibly damaging 0.60
IGL03302:Spag4 APN 2 156068420 missense probably damaging 0.97
R0314:Spag4 UTSW 2 156067309 unclassified probably benign
R0441:Spag4 UTSW 2 156067979 missense probably damaging 1.00
R1699:Spag4 UTSW 2 156065422 missense probably damaging 1.00
R5270:Spag4 UTSW 2 156065933 intron probably benign
R5293:Spag4 UTSW 2 156066191 missense probably benign 0.07
R6092:Spag4 UTSW 2 156065776 intron probably benign
R7138:Spag4 UTSW 2 156066599 missense probably benign 0.00
R7300:Spag4 UTSW 2 156065621 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCGCAAACCTGACTATGCACTGAG -3'
(R):5'- TGCCTAGCCAGACGAAGCAATG -3'

Sequencing Primer
(F):5'- GACGGTCCTAGACAGCCATTC -3'
(R):5'- AGTGTTAAGTCCAGATTCTGCC -3'
Posted On2013-04-11