Incidental Mutation 'R2020:Tsc22d1'
ID223881
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
MMRRC Submission 040029-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R2020 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76418333 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 751 (S751P)
Ref Sequence ENSEMBL: ENSMUSP00000044517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]
Predicted Effect probably damaging
Transcript: ENSMUST00000048371
AA Change: S751P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: S751P

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110888
AA Change: S669P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: S669P

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175984
SMART Domains Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 77 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176581
SMART Domains Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 78 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177333
Predicted Effect probably benign
Transcript: ENSMUST00000177471
SMART Domains Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 18 55 N/A INTRINSIC
Meta Mutation Damage Score 0.004 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5400:Tsc22d1 UTSW 14 76417054 missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5726:Tsc22d1 UTSW 14 76505317 nonsense probably null
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R6904:Tsc22d1 UTSW 14 76506483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGATTCCTGTGGCTCAG -3'
(R):5'- GCAACTGCTGGGAAACAACC -3'

Sequencing Primer
(F):5'- TCAGGCACAGGGGATCCAG -3'
(R):5'- GGGCCACGGTTTCTACTC -3'
Posted On2014-08-25