Incidental Mutation 'R2041:Tmem87b'
ID224884
Institutional Source Beutler Lab
Gene Symbol Tmem87b
Ensembl Gene ENSMUSG00000014353
Gene Nametransmembrane protein 87B
Synonyms
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2041 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128818118-128854261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128831589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 251 (V251A)
Ref Sequence ENSEMBL: ENSMUSP00000119093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110325] [ENSMUST00000152210]
Predicted Effect probably damaging
Transcript: ENSMUST00000110325
AA Change: V266A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105954
Gene: ENSMUSG00000014353
AA Change: V266A

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Lung_7-TM_R 174 459 3.7e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143398
Predicted Effect probably damaging
Transcript: ENSMUST00000152210
AA Change: V251A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119093
Gene: ENSMUSG00000014353
AA Change: V251A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Lung_7-TM_R 159 452 1.6e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178354
AA Change: V266A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136169
Gene: ENSMUSG00000014353
AA Change: V266A

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Lung_7-TM_R 174 467 1.4e-97 PFAM
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may interact with human papillomavirus type 18 E6 oncogene. The protein is also likely to be involved in endosome-to-trans-Golgi network retrograde transport. The gene is expressed in adult and fetal tissues, including brain and heart. This gene is a component of the 2q13 deletion syndrome. Mutations in this gene may be associated with congenital heart defects. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Alox8 T A 11: 69,197,691 H40L possibly damaging Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Gpr153 A G 4: 152,283,353 S554G probably benign Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Ndst3 C A 3: 123,672,215 G36V probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1154 T C 2: 87,902,797 N293S probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Ube3b T C 5: 114,387,233 L39P probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Tmem87b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Tmem87b APN 2 128831216 missense probably damaging 1.00
IGL02224:Tmem87b APN 2 128834207 missense possibly damaging 0.91
IGL03387:Tmem87b APN 2 128823099 missense probably benign 0.08
PIT4445001:Tmem87b UTSW 2 128831471 missense probably benign 0.02
R0054:Tmem87b UTSW 2 128831441 critical splice acceptor site probably benign
R0054:Tmem87b UTSW 2 128831441 critical splice acceptor site probably benign
R0363:Tmem87b UTSW 2 128831233 missense probably damaging 1.00
R0750:Tmem87b UTSW 2 128818436 missense possibly damaging 0.92
R1496:Tmem87b UTSW 2 128826393 splice site probably null
R1520:Tmem87b UTSW 2 128839256 critical splice donor site probably null
R1766:Tmem87b UTSW 2 128839170 missense probably damaging 0.96
R1908:Tmem87b UTSW 2 128831559 missense probably damaging 1.00
R3840:Tmem87b UTSW 2 128826384 nonsense probably null
R4426:Tmem87b UTSW 2 128846750 missense probably benign 0.00
R5105:Tmem87b UTSW 2 128831589 missense probably damaging 1.00
R5159:Tmem87b UTSW 2 128824458 missense probably benign 0.00
R5471:Tmem87b UTSW 2 128851320 missense possibly damaging 0.58
R6550:Tmem87b UTSW 2 128824465 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TAAAAGGGTCAGAGGCTCACAC -3'
(R):5'- AGTGCTTTACAAACTGAGCCAC -3'

Sequencing Primer
(F):5'- GGTCAGAGGCTCACACTGTTTC -3'
(R):5'- GCTTTACAAACTGAGCCACCTTCC -3'
Posted On2014-08-25