Incidental Mutation 'R2041:Ndst3'
ID224888
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R2041 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123672215 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 36 (G36V)
Ref Sequence ENSEMBL: ENSMUSP00000133657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably benign
Transcript: ENSMUST00000029602
AA Change: G36V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: G36V

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137404
AA Change: G36V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: G36V

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154668
AA Change: G36V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: G36V

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172537
AA Change: G36V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: G36V

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Alox8 T A 11: 69,197,691 H40L possibly damaging Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Gpr153 A G 4: 152,283,353 S554G probably benign Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1154 T C 2: 87,902,797 N293S probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Ube3b T C 5: 114,387,233 L39P probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGATAATGGAACCGGATGGATTC -3'
(R):5'- AGCGTGCCTGAAACTCCATC -3'

Sequencing Primer
(F):5'- AACCGGATGGATTCTAGCATC -3'
(R):5'- GTGCCTGAAACTCCATCCCTCC -3'
Posted On2014-08-25