Incidental Mutation 'R2071:Xpr1'
ID227108
Institutional Source Beutler Lab
Gene Symbol Xpr1
Ensembl Gene ENSMUSG00000026469
Gene Namexenotropic and polytropic retrovirus receptor 1
SynonymsRmc1, suppressor of yeast G deletion, Syg1, Rmc-1
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155275701-155417415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155290280 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 574 (T574A)
Ref Sequence ENSEMBL: ENSMUSP00000107404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027741] [ENSMUST00000111774] [ENSMUST00000111775]
Predicted Effect probably benign
Transcript: ENSMUST00000027741
AA Change: T574A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027741
Gene: ENSMUSG00000026469
AA Change: T574A

DomainStartEndE-ValueType
Pfam:SPX 1 174 1.4e-33 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 268 616 5.8e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111774
AA Change: T574A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107404
Gene: ENSMUSG00000026469
AA Change: T574A

DomainStartEndE-ValueType
Pfam:SPX 1 176 1.5e-38 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 617 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111775
AA Change: T509A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107405
Gene: ENSMUSG00000026469
AA Change: T509A

DomainStartEndE-ValueType
Pfam:SPX 1 176 4.5e-39 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 434 3.6e-45 PFAM
Pfam:EXS 432 552 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192359
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for the xenotropic and polytropic classes of murine leukemia viruses. The encoded protein is involved in phosphate homeostasis by mediating phosphate export from the cell. Defects in this gene have been associated with idiopathic basal ganglia calcification-6. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes and heterozygotes for a variant from some wild Mus stocks, including M. spretus, support replication of xenotropic murine leukemia viruses and mink cell focus-forming murine leukemia viruses that are not replicated in most laboratory strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Xpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Xpr1 APN 1 155290234 missense probably benign 0.00
IGL02657:Xpr1 APN 1 155290280 missense probably benign 0.05
IGL03077:Xpr1 APN 1 155281028 missense possibly damaging 0.58
R0019:Xpr1 UTSW 1 155332399 splice site probably benign
R0350:Xpr1 UTSW 1 155330468 missense probably damaging 1.00
R1299:Xpr1 UTSW 1 155417203 missense probably damaging 0.99
R1855:Xpr1 UTSW 1 155283256 missense probably benign
R2008:Xpr1 UTSW 1 155281029 unclassified probably null
R4293:Xpr1 UTSW 1 155312796 missense possibly damaging 0.91
R4509:Xpr1 UTSW 1 155290161 intron probably benign
R5060:Xpr1 UTSW 1 155328684 critical splice acceptor site probably null
R5527:Xpr1 UTSW 1 155290235 missense probably benign
R5586:Xpr1 UTSW 1 155312863 missense probably benign
R5860:Xpr1 UTSW 1 155332122 intron probably benign
R7565:Xpr1 UTSW 1 155307742 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGTGTCATCTGGGGATCAG -3'
(R):5'- TGAACAGTGCACTATTTAGGAAAGC -3'

Sequencing Primer
(F):5'- CTGGGGATCAGACTTGGTATAAG -3'
(R):5'- TTAGGAAAGCTAAAACCTATGCAACG -3'
Posted On2014-09-17