Incidental Mutation 'R2131:Akap13'
ID228085
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 040134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2131 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75611434 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1269 (A1269S)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: A1269S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: A1269S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000154740
AA Change: A111S
Predicted Effect probably benign
Transcript: ENSMUST00000166315
AA Change: A1269S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: A1269S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207079
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: A1269S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000207923
AA Change: A466S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect unknown
Transcript: ENSMUST00000208708
AA Change: A111S
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
4931408C20Rik T C 1: 26,685,854 R82G probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Acvr2b A G 9: 119,432,808 R437G probably damaging Het
Adamtsl3 C A 7: 82,578,594 A1329E probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adra1a A T 14: 66,727,532 I324F possibly damaging Het
Ampd1 G T 3: 103,094,878 probably null Het
Ankrd16 T A 2: 11,783,695 D211E probably damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apc C A 18: 34,312,045 Q665K possibly damaging Het
Arap2 T C 5: 62,677,958 N747S probably damaging Het
Arsk A T 13: 76,091,812 C47* probably null Het
Atp8b5 T A 4: 43,370,726 F1001I probably benign Het
Bap1 T A 14: 31,258,331 Y645* probably null Het
Brca2 A G 5: 150,557,129 Y2760C probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Cdkn2c A C 4: 109,665,063 N28K probably null Het
Celsr1 T A 15: 85,963,223 I1438F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cldn1 G C 16: 26,371,550 A26G probably damaging Het
Col20a1 T A 2: 180,992,573 F110L probably damaging Het
Creg2 T C 1: 39,624,978 N204S probably benign Het
Cx3cl1 C A 8: 94,779,573 Q69K probably benign Het
Cyfip2 T C 11: 46,286,131 E74G possibly damaging Het
Cyp2g1 A T 7: 26,820,710 I456F probably damaging Het
Dapk1 A G 13: 60,729,531 E528G possibly damaging Het
Dapk1 T A 13: 60,761,667 W1365R possibly damaging Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Depdc5 T A 5: 32,990,781 L1469* probably null Het
Dnah3 T A 7: 119,967,759 T2415S possibly damaging Het
Dnmbp A G 19: 43,854,311 L1210S probably damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Eya1 A G 1: 14,170,974 V573A probably benign Het
Fam171b T A 2: 83,879,858 S625T probably damaging Het
Fam186a T C 15: 99,933,676 probably benign Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Gabra4 G T 5: 71,641,224 D137E probably benign Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm43302 T C 5: 105,274,744 D474G probably damaging Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gpr19 T C 6: 134,870,442 M1V probably null Het
Hnf4a T A 2: 163,547,418 N29K probably benign Het
Htt A G 5: 34,877,109 R1975G possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Il4i1 G A 7: 44,840,070 V420M probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd4 A T 11: 59,454,955 H287L probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Kdm5d T C Y: 941,483 L1228P probably benign Het
Klra3 A G 6: 130,335,775 S9P probably benign Het
Ldhd C T 8: 111,628,537 probably null Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmo7 A T 14: 101,900,238 D670V probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lrp5 T C 19: 3,622,708 T534A possibly damaging Het
Lrrc24 A T 15: 76,715,581 F453I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Med4 A G 14: 73,517,996 N248S possibly damaging Het
Mest C T 6: 30,745,885 L269F probably damaging Het
Mib2 C T 4: 155,655,238 probably null Het
Mki67 T A 7: 135,704,241 probably null Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Nbr1 T A 11: 101,566,191 probably null Het
Ncapd3 T G 9: 27,083,346 V1174G probably damaging Het
Nyap1 A C 5: 137,733,681 probably null Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr775 T C 10: 129,251,074 F180S probably benign Het
Oosp1 T C 19: 11,690,950 D23G probably damaging Het
Optc A T 1: 133,903,796 probably null Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Otog A T 7: 46,250,100 N275I probably damaging Het
Pcdhb14 C A 18: 37,447,870 Q10K probably benign Het
Pcx T C 19: 4,602,551 F189L probably benign Het
Pde6b A G 5: 108,428,203 D718G probably damaging Het
Pklr C A 3: 89,142,660 P314Q probably damaging Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Plekho1 A G 3: 95,989,117 S347P probably damaging Het
Plxna2 G A 1: 194,644,750 D331N probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Prkra A T 2: 76,647,136 I75K probably damaging Het
Ptpn11 G A 5: 121,172,026 A31V probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Rbm12 A T 2: 156,095,510 C947* probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Sarm1 A T 11: 78,475,307 C649S probably benign Het
Sept12 T A 16: 4,991,779 Q223L probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc22a21 A T 11: 53,979,733 L42Q probably damaging Het
Slc44a1 GCCC GCCCCCCC 4: 53,563,246 probably null Het
Slc9a4 T G 1: 40,607,741 probably null Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Spag6 T A 2: 18,733,097 C259* probably null Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Stk24 A T 14: 121,302,211 I191N probably damaging Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tacc2 T A 7: 130,621,857 S91T possibly damaging Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tbccd1 A G 16: 22,841,989 S26P probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tor1aip2 A G 1: 156,065,349 Y467C probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc9b T A 7: 27,654,349 probably null Het
Tti1 T C 2: 158,000,743 R789G probably benign Het
Ttn A T 2: 76,832,217 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2cbp A T 9: 86,372,487 probably null Het
Vav2 C A 2: 27,299,396 R176L possibly damaging Het
Wdr27 T A 17: 14,928,332 D133V probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp467 A C 6: 48,442,661 S38A probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATGTGCCTACCAGAGCAG -3'
(R):5'- CAACTTACATGACTGAGCAAGTAGG -3'

Sequencing Primer
(F):5'- TACCAGAGCAGACTCCATAGAGG -3'
(R):5'- TTACATGACTGAGCAAGTAGGACTAC -3'
Posted On2014-09-17