Incidental Mutation 'R2178:Tgfb1'
ID 236997
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Name transforming growth factor, beta 1
Synonyms Tgfb, TGF-beta1, TGF-beta 1, Tgfb-1, TGFbeta1
MMRRC Submission 040180-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R2178 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 25386427-25404502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25404234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 347 (N347S)
Ref Sequence ENSEMBL: ENSMUSP00000002678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678]
AlphaFold P04202
Predicted Effect probably damaging
Transcript: ENSMUST00000002678
AA Change: N347S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603
AA Change: N347S

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 A T 15: 98,492,236 (GRCm39) N1007K probably damaging Het
Apon C A 10: 128,090,634 (GRCm39) A104E probably benign Het
Cdh15 T A 8: 123,591,715 (GRCm39) probably null Het
Cep135 T C 5: 76,779,297 (GRCm39) V769A probably benign Het
Cep152 A T 2: 125,421,954 (GRCm39) probably null Het
Clca3a1 T C 3: 144,711,863 (GRCm39) N711D probably damaging Het
Col1a2 T C 6: 4,531,143 (GRCm39) F731L unknown Het
Cpt1b T C 15: 89,303,246 (GRCm39) E603G probably damaging Het
Cspp1 T G 1: 10,174,471 (GRCm39) D641E possibly damaging Het
Ddr2 C T 1: 169,822,251 (GRCm39) R399Q probably benign Het
Dzip1 T C 14: 119,126,816 (GRCm39) probably null Het
Greb1 A G 12: 16,746,388 (GRCm39) V1294A probably damaging Het
Hmgb4 A G 4: 128,154,275 (GRCm39) S98P probably damaging Het
Kif12 G A 4: 63,085,196 (GRCm39) P515L probably benign Het
Kmt5b A C 19: 3,865,372 (GRCm39) E789A possibly damaging Het
Lama1 G T 17: 68,076,510 (GRCm39) V1095F probably benign Het
Leprot T C 4: 101,513,308 (GRCm39) V32A probably benign Het
Mcoln1 A G 8: 3,558,766 (GRCm39) T255A probably damaging Het
Mertk G A 2: 128,634,984 (GRCm39) E765K probably damaging Het
Muc5b A G 7: 141,417,853 (GRCm39) T3600A possibly damaging Het
Ncapd3 A T 9: 26,999,845 (GRCm39) E1395V probably benign Het
Ntrk2 T C 13: 58,956,616 (GRCm39) F25S probably benign Het
Or2a5 A G 6: 42,873,732 (GRCm39) M116V probably benign Het
Or6z1 G T 7: 6,504,487 (GRCm39) A246D probably damaging Het
Or7c70 T A 10: 78,683,612 (GRCm39) I46F probably damaging Het
Pappa C A 4: 65,269,924 (GRCm39) H1613N probably benign Het
Polq T C 16: 36,883,191 (GRCm39) V1785A probably damaging Het
Pramel23 A T 4: 143,424,612 (GRCm39) I277K possibly damaging Het
Prkar2a T C 9: 108,617,737 (GRCm39) probably null Het
Qrich2 T C 11: 116,334,603 (GRCm39) D2194G probably damaging Het
Rnf183 T C 4: 62,346,333 (GRCm39) N155S probably benign Het
S1pr5 T C 9: 21,155,760 (GRCm39) N222S probably benign Het
Scnn1a C T 6: 125,307,965 (GRCm39) R170C probably damaging Het
Slc25a2 T C 18: 37,771,311 (GRCm39) T73A probably benign Het
Ticrr T C 7: 79,315,433 (GRCm39) V229A probably benign Het
Tjp3 T C 10: 81,115,941 (GRCm39) E313G probably benign Het
Tnfsf11 A G 14: 78,521,682 (GRCm39) S176P probably benign Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vps39 C A 2: 120,154,160 (GRCm39) E612* probably null Het
Vwf T A 6: 125,619,095 (GRCm39) Y1258N possibly damaging Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25,387,442 (GRCm39) missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25,403,621 (GRCm39) missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25,396,343 (GRCm39) missense probably benign
R0004:Tgfb1 UTSW 7 25,391,791 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0048:Tgfb1 UTSW 7 25,393,779 (GRCm39) splice site probably benign
R0470:Tgfb1 UTSW 7 25,387,355 (GRCm39) unclassified probably benign
R1872:Tgfb1 UTSW 7 25,391,891 (GRCm39) missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25,396,655 (GRCm39) missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25,387,574 (GRCm39) missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25,393,706 (GRCm39) missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25,396,385 (GRCm39) missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25,396,350 (GRCm39) missense probably benign 0.01
R6727:Tgfb1 UTSW 7 25,388,587 (GRCm39) unclassified probably benign
R7203:Tgfb1 UTSW 7 25,391,964 (GRCm39) critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25,404,263 (GRCm39) missense probably damaging 1.00
R7654:Tgfb1 UTSW 7 25,387,120 (GRCm39) unclassified probably benign
R8257:Tgfb1 UTSW 7 25,396,373 (GRCm39) missense probably damaging 0.97
R9124:Tgfb1 UTSW 7 25,388,580 (GRCm39) nonsense probably null
R9418:Tgfb1 UTSW 7 25,391,952 (GRCm39) missense probably damaging 1.00
Z1177:Tgfb1 UTSW 7 25,387,633 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGAGAGCTAGTGATGT -3'
(R):5'- CTGTCACCTTTAATGGGCCC -3'

Sequencing Primer
(F):5'- GCTAGTGATGTGGAGAGATACAG -3'
(R):5'- GTGCAGGTGTCCTTAAATACAGCC -3'
Posted On 2014-10-02