Incidental Mutation 'R2173:Impdh2'
ID237630
Institutional Source Beutler Lab
Gene Symbol Impdh2
Ensembl Gene ENSMUSG00000062867
Gene Nameinosine monophosphate dehydrogenase 2
SynonymsIMP dehydrogenase type II
MMRRC Submission 040175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2173 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108560286-108565584 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 108565394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000193421] [ENSMUST00000194381] [ENSMUST00000194904] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081111
AA Change: V503I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867
AA Change: V503I

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193421
SMART Domains Protein: ENSMUSP00000142117
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 248 1.3e-18 SMART
CBS 92 143 4.5e-9 SMART
CBS 159 207 7.6e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194365
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably null
Transcript: ENSMUST00000194904
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Meta Mutation Damage Score 0.634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities resulting in embryonic lethality around the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A C 17: 25,948,487 H25Q probably damaging Het
Alpk1 T A 3: 127,683,590 H273L probably damaging Het
Alpk3 A G 7: 81,076,900 Y111C probably damaging Het
Anapc2 T G 2: 25,273,276 V175G probably benign Het
Arhgap30 T C 1: 171,407,767 S570P probably damaging Het
AU040320 T C 4: 126,792,276 L215P probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc65 A G 15: 98,721,033 N298D probably benign Het
Cfap70 T A 14: 20,408,562 N727Y probably benign Het
Clcn7 A G 17: 25,145,609 H63R probably benign Het
Corin A T 5: 72,504,079 C24S probably benign Het
Cyp1a2 A G 9: 57,677,515 W419R probably damaging Het
Dlgap4 C A 2: 156,762,812 A256D probably damaging Het
Eif4enif1 A G 11: 3,242,367 probably null Het
Eri2 A G 7: 119,786,543 V245A possibly damaging Het
Erich6b T C 14: 75,658,892 F73L probably benign Het
Fam110a A G 2: 151,970,509 C114R probably damaging Het
Fam149a T C 8: 45,353,954 D288G probably damaging Het
Fam171a1 T A 2: 3,225,619 Y596* probably null Het
Fsd1 A G 17: 55,991,223 T183A possibly damaging Het
Fut10 T A 8: 31,236,131 Y305N probably damaging Het
Ganab A T 19: 8,902,260 probably benign Het
Gm9922 G T 14: 101,729,576 probably benign Het
Gp9 A G 6: 87,779,053 T17A probably benign Het
Gxylt2 T C 6: 100,798,154 Y345H probably damaging Het
Herc2 A G 7: 56,185,951 H3269R probably benign Het
Hpx A T 7: 105,592,083 S374T probably benign Het
Hspa5 T C 2: 34,774,662 V376A probably damaging Het
Hyi T C 4: 118,362,184 probably benign Het
Kremen2 A C 17: 23,742,796 W246G probably damaging Het
Krt83 A G 15: 101,487,937 V259A probably damaging Het
L3mbtl4 A T 17: 68,587,193 H398L probably damaging Het
Lama5 C A 2: 180,196,242 V894L probably benign Het
Maml2 A G 9: 13,621,616 probably benign Het
Nup153 A T 13: 46,701,600 probably benign Het
Olfr1387 G T 11: 49,460,140 V154L probably benign Het
Olfr177 A G 16: 58,872,619 F177S probably damaging Het
Olfr824 G A 10: 130,126,503 P185S probably benign Het
Olfr918 T C 9: 38,672,944 I180V probably benign Het
Olfr981 T G 9: 40,023,254 I287S probably damaging Het
Otof C T 5: 30,386,374 R582H probably damaging Het
Otud4 T C 8: 79,668,464 S543P probably damaging Het
Pde6a A G 18: 61,254,382 D448G probably damaging Het
Phgdh A G 3: 98,315,111 V388A probably benign Het
Plin3 G T 17: 56,279,891 D385E possibly damaging Het
Polg G T 7: 79,455,593 D734E probably damaging Het
Pomt1 T C 2: 32,250,900 Y515H probably damaging Het
Pwwp2a G A 11: 43,682,486 A132T probably benign Het
Rbm6 A T 9: 107,852,191 F419L possibly damaging Het
Rfx5 A G 3: 94,956,716 probably null Het
Rnf135 G A 11: 80,189,240 S119N probably benign Het
Scfd1 T A 12: 51,387,079 D51E probably benign Het
Smox A T 2: 131,512,024 E5D possibly damaging Het
Srpk2 T C 5: 23,518,615 probably null Het
Syne2 T A 12: 76,100,989 probably benign Het
Tcf20 A G 15: 82,854,692 S853P possibly damaging Het
Tmem131l A G 3: 83,926,145 F804L probably damaging Het
Ttll8 A G 15: 88,914,597 L645P probably damaging Het
Ubr3 T A 2: 69,897,399 H35Q probably benign Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Vmn2r70 A T 7: 85,565,082 H287Q probably benign Het
Vps26a A T 10: 62,468,392 I150N probably damaging Het
Zfp605 G A 5: 110,127,457 R147H probably benign Het
Zfyve16 A G 13: 92,495,088 M1333T probably damaging Het
Other mutations in Impdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Impdh2 UTSW 9 108561661 missense probably damaging 1.00
R0523:Impdh2 UTSW 9 108561819 unclassified probably null
R0523:Impdh2 UTSW 9 108561820 missense possibly damaging 0.80
R0644:Impdh2 UTSW 9 108563637 missense possibly damaging 0.56
R0648:Impdh2 UTSW 9 108563466 missense probably benign 0.01
R0905:Impdh2 UTSW 9 108561097 unclassified probably benign
R1173:Impdh2 UTSW 9 108561829 missense probably benign 0.19
R1202:Impdh2 UTSW 9 108563187 missense probably damaging 1.00
R1441:Impdh2 UTSW 9 108564776 missense probably benign 0.12
R1818:Impdh2 UTSW 9 108563212 unclassified probably null
R2141:Impdh2 UTSW 9 108565347 missense possibly damaging 0.50
R2438:Impdh2 UTSW 9 108560616 missense probably benign 0.06
R4061:Impdh2 UTSW 9 108562804 missense possibly damaging 0.46
R4273:Impdh2 UTSW 9 108564956 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108564671 missense probably damaging 1.00
R4847:Impdh2 UTSW 9 108565515 missense probably benign 0.00
R5073:Impdh2 UTSW 9 108563336 critical splice donor site probably null
R5896:Impdh2 UTSW 9 108563966 missense probably benign 0.06
R6315:Impdh2 UTSW 9 108563439 missense possibly damaging 0.66
R7172:Impdh2 UTSW 9 108560610 missense probably benign 0.00
R7182:Impdh2 UTSW 9 108563208 missense possibly damaging 0.56
R7241:Impdh2 UTSW 9 108563437 missense possibly damaging 0.78
X0066:Impdh2 UTSW 9 108561787 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACATTGGTGCCAAGAGTTTAACC -3'
(R):5'- AAAACTGCAAGTGCCCATTG -3'

Sequencing Primer
(F):5'- GTTTAACCCAAGTCAGGTAAGCTTGG -3'
(R):5'- TGCAAGTGCCCATTGAACTC -3'
Posted On2014-10-02