Incidental Mutation 'R2437:4921507P07Rik'
ID249653
Institutional Source Beutler Lab
Gene Symbol 4921507P07Rik
Ensembl Gene ENSMUSG00000029828
Gene NameRIKEN cDNA 4921507P07 gene
Synonyms
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location50573302-50596632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50583979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 212 (D212V)
Ref Sequence ENSEMBL: ENSMUSP00000031852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031852]
Predicted Effect probably damaging
Transcript: ENSMUST00000031852
AA Change: D212V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031852
Gene: ENSMUSG00000029828
AA Change: D212V

DomainStartEndE-ValueType
Pfam:DUF4555 1 283 2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147260
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in 4921507P07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:4921507P07Rik APN 6 50589184 critical splice acceptor site probably null
IGL01310:4921507P07Rik APN 6 50574195 missense probably benign
IGL01568:4921507P07Rik APN 6 50573698 utr 3 prime probably benign
IGL01794:4921507P07Rik APN 6 50577846 missense probably damaging 1.00
IGL02718:4921507P07Rik APN 6 50584387 missense probably damaging 1.00
IGL03146:4921507P07Rik APN 6 50573873 missense probably damaging 0.97
IGL03381:4921507P07Rik APN 6 50589136 missense probably damaging 1.00
R1173:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1174:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1175:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1769:4921507P07Rik UTSW 6 50591821 splice site probably benign
R1883:4921507P07Rik UTSW 6 50574453 missense probably benign 0.01
R2056:4921507P07Rik UTSW 6 50573745 missense possibly damaging 0.71
R2929:4921507P07Rik UTSW 6 50574305 missense probably benign 0.07
R4357:4921507P07Rik UTSW 6 50574210 missense probably benign
R4666:4921507P07Rik UTSW 6 50595828 missense possibly damaging 0.69
R4791:4921507P07Rik UTSW 6 50595837 missense probably damaging 1.00
R4827:4921507P07Rik UTSW 6 50595856 missense possibly damaging 0.76
R4976:4921507P07Rik UTSW 6 50589184 critical splice acceptor site probably null
R5453:4921507P07Rik UTSW 6 50595796 critical splice donor site probably null
R6689:4921507P07Rik UTSW 6 50589109 critical splice donor site probably null
R6897:4921507P07Rik UTSW 6 50589165 missense possibly damaging 0.82
X0021:4921507P07Rik UTSW 6 50573926 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAACAGTCAACCATGTGAAC -3'
(R):5'- TGCACTTCACGCACAGCATC -3'

Sequencing Primer
(F):5'- ACTGATTCAGCTGGACAGTC -3'
(R):5'- CTGTGGTAGAAACAGGATCTCTCTC -3'
Posted On2014-11-12