Incidental Mutation 'R2844:Atg4a'
ID251485
Institutional Source Beutler Lab
Gene Symbol Atg4a
Ensembl Gene ENSMUSG00000079418
Gene Nameautophagy related 4A, cysteine peptidase
Synonymsautophagin 2, Autl2, Apg4a
MMRRC Submission 040437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R2844 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location140956907-141164270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140992840 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 106 (E106K)
Ref Sequence ENSEMBL: ENSMUSP00000108595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112971]
Predicted Effect probably benign
Transcript: ENSMUST00000112971
AA Change: E106K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108595
Gene: ENSMUSG00000079418
AA Change: E106K

DomainStartEndE-ValueType
Pfam:Peptidase_C54 42 333 5.7e-102 PFAM
low complexity region 381 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153742
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,164 I186F probably benign Het
Afg3l1 T C 8: 123,494,939 probably benign Het
C130079G13Rik G A 3: 59,936,409 V175I probably benign Het
Ccdc50 A G 16: 27,406,729 E64G probably damaging Het
Celsr3 G T 9: 108,829,308 G997W probably damaging Het
Chd8 C T 14: 52,204,495 E2138K possibly damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Fzr1 G T 10: 81,369,418 T159K probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gna13 T C 11: 109,363,125 I51T probably damaging Het
Gorab A G 1: 163,396,806 probably null Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Ints6 A G 14: 62,704,826 V486A probably damaging Het
Irx2 A G 13: 72,631,590 K331R probably damaging Het
Lrrc6 A G 15: 66,447,676 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Med14 A T X: 12,683,996 H684Q probably benign Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pde5a T C 3: 122,851,708 L755P probably damaging Het
Pex14 A T 4: 148,963,511 I203N probably benign Het
Pi4ka T C 16: 17,350,793 E691G probably damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Pnoc A T 14: 65,404,835 F160I probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Ppil6 A T 10: 41,501,693 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Psme4 T C 11: 30,845,173 probably benign Het
Rfx3 T C 19: 27,806,786 probably benign Het
Rnase11 A G 14: 51,049,770 L109S probably damaging Het
Rngtt A G 4: 33,368,678 T404A probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Sema5b A G 16: 35,659,931 N656S probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Thbs1 C T 2: 118,117,628 T423I probably benign Het
Ttc17 A T 2: 94,376,074 Y243* probably null Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp648 A T 1: 154,205,135 K347* probably null Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Atg4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Atg4a APN X 141162492 missense probably damaging 0.99
R2256:Atg4a UTSW X 140990235 missense probably benign 0.00
R2257:Atg4a UTSW X 140990235 missense probably benign 0.00
R2845:Atg4a UTSW X 140992840 missense probably benign
R2846:Atg4a UTSW X 140992840 missense probably benign
R2921:Atg4a UTSW X 141158772 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAACACCTTGCCATTCCTGC -3'
(R):5'- TCCAAACCATTCGCCAATTG -3'

Sequencing Primer
(F):5'- GCCATTCCTGCCTTTTGGATGTAG -3'
(R):5'- AAACCATTCGCCAATTGATTTCC -3'
Posted On2014-12-04