Incidental Mutation 'R2865:March4'
ID253134
Institutional Source Beutler Lab
Gene Symbol March4
Ensembl Gene ENSMUSG00000039372
Gene Namemembrane-associated ring finger (C3HC4) 4
Synonyms
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location72427112-72536930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72452575 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 179 (R179H)
Ref Sequence ENSEMBL: ENSMUSP00000042803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047786]
Predicted Effect probably damaging
Transcript: ENSMUST00000047786
AA Change: R179H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042803
Gene: ENSMUSG00000039372
AA Change: R179H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 125 135 N/A INTRINSIC
RINGv 161 208 3.5e-18 SMART
transmembrane domain 235 257 N/A INTRINSIC
Blast:AAA 263 290 4e-9 BLAST
low complexity region 344 360 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH4 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH4 reduces surface accumulation of several membrane glycoproteins by directing them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in March4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:March4 APN 1 72452531 nonsense probably null
IGL02996:March4 APN 1 72428899 nonsense probably null
R0245:March4 UTSW 1 72534781 missense probably benign 0.00
R4386:March4 UTSW 1 72428814 missense probably benign 0.00
R4917:March4 UTSW 1 72428779 missense probably benign 0.27
R4918:March4 UTSW 1 72428779 missense probably benign 0.27
R5812:March4 UTSW 1 72428917 missense probably benign
R6266:March4 UTSW 1 72452488 missense probably damaging 1.00
R7247:March4 UTSW 1 72452478 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAAGCTGCCCTGAATTTG -3'
(R):5'- GTGCCTCCAGACAATATTTGTG -3'

Sequencing Primer
(F):5'- GAGGTTTGGTAATTCCCCTACC -3'
(R):5'- TACCTATCTATCACCTGCGG -3'
Posted On2014-12-04